Abcam Ace2 Elisa

Lab Reagents

Ace2 Elisa Laboratories manufactures the abcam ace2 elisa reagents distributed by Genprice. The Abcam Ace2 Elisa reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact ACE2 Elisa. Other Abcam products are available in stock. Specificity: Abcam Category: Ace2 Group: Elisa

Elisa information

Human Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit
RD-ACE2-Hu-48Tests 48 Tests
EUR 362

Human Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit
RD-ACE2-Hu-96Tests 96 Tests
EUR 496

Mouse Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit
RD-ACE2-Mu-48Tests 48 Tests
EUR 511

Mouse Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit
RD-ACE2-Mu-96Tests 96 Tests
EUR 709

Rat Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit
RD-ACE2-Ra-48Tests 48 Tests
EUR 473

Rat Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit
RD-ACE2-Ra-96Tests 96 Tests
EUR 655

Human Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit
RDR-ACE2-Hu-48Tests 48 Tests
EUR 378

Human Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit
RDR-ACE2-Hu-96Tests 96 Tests
EUR 519

Mouse Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit
RDR-ACE2-Mu-48Tests 48 Tests
EUR 534

Mouse Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit
RDR-ACE2-Mu-96Tests 96 Tests
EUR 742

Rat Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit
RDR-ACE2-Ra-48Tests 48 Tests
EUR 495

Rat Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit
RDR-ACE2-Ra-96Tests 96 Tests
EUR 685

Ace2/ Rat Ace2 ELISA Kit
ELI-06051r 96 Tests
EUR 886

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202

Human ACE2 ELISA Kit
EHA0506 96Tests
EUR 521

Human ACE2 ELISA Kit
ELA-E1886h 96 Tests
EUR 824

Goat ACE2 ELISA Kit
EGTA0506 96Tests
EUR 521

ACE2 (Human) ELISA Kit
E4528-100
EUR 805

Canine ACE2 ELISA Kit
ECA0506 96Tests
EUR 521

Chicken ACE2 ELISA Kit
ECKA0506 96Tests
EUR 521

Anserini ACE2 ELISA Kit
EAA0506 96Tests
EUR 521

Bovine ACE2 ELISA Kit
EBA0506 96Tests
EUR 521

ACE2 ELISA KIT|Human
EF000020 96 Tests
EUR 689

Mouse ACE2 ELISA Kit
EMA0506 96Tests
EUR 521

Rat ACE2 ELISA Kit
ERA0506 96Tests
EUR 521

Sheep ACE2 ELISA Kit
ESA0506 96Tests
EUR 521

Rabbit ACE2 ELISA Kit
ERTA0506 96Tests
EUR 521

Monkey ACE2 ELISA Kit
EMKA0506 96Tests
EUR 521

Porcine ACE2 ELISA Kit
EPA0506 96Tests
EUR 521

Human ACE2 ELISA Kit
LF-EK70020 1×96T
EUR 602

ACE2 Antibody
24214-100ul 100ul
EUR 390

ACE2 Antibody
24215-100ul 100ul
EUR 390

ACE2 Antibody
24220-100ul 100ul
EUR 390

ACE2 Antibody
24221-100ul 100ul
EUR 390

ACE2 antibody
70R-15539 50 ul
EUR 435
Description: Rabbit polyclonal ACE2 antibody

ACE2 Antibody
35524-100ul 100ul
EUR 390

ACE2 Antibody
36103-100ul 100ul
EUR 252

ACE2 Antibody
1-CSB-PA111496
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ACE2. Recognizes ACE2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

ACE2 Antibody
1-CSB-PA445794
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ACE2. Recognizes ACE2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100

ACE2 Antibody
1-CSB-PA040178
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ACE2. Recognizes ACE2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

ACE2 antibody
70R-7469 50 ug
EUR 467
Description: Rabbit polyclonal ACE2 antibody

ACE2 Antibody
AF5165 200ul
EUR 304
Description: ACE2 Antibody detects endogenous levels of total ACE2.

ACE2 Antibody
1-CSB-PA025395
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ACE2. Recognizes ACE2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300

ACE2 siRNA
20-abx900112
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ACE2 siRNA
20-abx906492
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ACE2 siRNA
20-abx906493
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ACE2 Antibody
ABF5165 100 ug
EUR 438

ELISA kit for Human ACE2
EK5468 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human ACE2 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Mouse ACE2
EK5518 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse ACE2 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human ACE2 PicoKine ELISA Kit
EK0997 96 wells
EUR 455
Description: For quantitative detection of human ACE2 in cell culture supernates, serum and plasma(heparin).

Mouse ACE2 PicoKine ELISA Kit
EK1188 96 wells
EUR 455
Description: For quantitative detection of Mouse ACE2 in cell culture supernates, serum and plasma(heparin).

Guinea Pig ACE2 ELISA Kit
EGA0506 96Tests
EUR 521

ACE2 ELISA Kit (Rat) (OKAN05651)
OKAN05651 96 Wells
EUR 792
Description: Description of target: enzyme peptidyl-dipeptidase; mouse homolog has a role in regulation of cardiac contractility and regulating Angiotensin 1 and 2 levels [RGD, Feb 2006];Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.31 ng/mL

ACE2 ELISA Kit (Human) (OKAN05734)
OKAN05734 96 Wells
EUR 792
Description: Description of target: The protein encoded by this gene belongs to the angiotensin-converting enzyme family of dipeptidyl carboxydipeptidases and has considerable homology to human angiotensin 1 converting enzyme. This secreted protein catalyzes the cleavage of angiotensin I into angiotensin 1-9, and angiotensin II into the vasodilator angiotensin 1-7. The organ- and cell-specific expression of this gene suggests that it may play a role in the regulation of cardiovascular and renal function, as well as fertility. In addition, the encoded protein is a functional receptor for the spike glycoprotein of the human coronaviruses SARS and HCoV-NL63.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.4 pg/mL

ACE2 ELISA Kit (Mouse) (OKAN05813)
OKAN05813 96 Wells
EUR 792
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 5.5 pg/mL

ACE2 ELISA Kit (Human) (OKBB00649)
OKBB00649 96 Wells
EUR 544
Description: Description of target: AngiotensinI-converting enzyme 2 (ACE 2) is a protein belongs to the angiotensin-converting enzyme family of dipeptidyl carboxydipeptidases and has considerable homology to human angiotensin 1 converting enzyme. By sequence similarity to a sequence in GenBank, this gene is mapped to Xp22.2. This secreted protein catalyzes the cleavage of angiotensin I into angiotensin 1-9, and angiotensin II into the vasodilator angiotensin 1-7. The organ- and cell-specific expression of this gene suggests that it may play a role in the regulation of cardiovascular and renal function, as well as fertility. In addition, the encoded protein is a functional receptor for the spike glycoprotein of the human coronaviruses SARS and HCoV-NL63.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 10 pg/mL

ACE2 ELISA Kit (Mouse) (OKBB00657)
OKBB00657 96 Wells
EUR 544
Description: Description of target: AngiotensinI-converting enzyme 2 (ACE 2) is a protein belongs to the angiotensin-converting enzyme family of dipeptidyl carboxydipeptidases and has considerable homology to human angiotensin 1 converting enzyme. By sequence similarity to a sequence in GenBank, this gene is mapped to Xp22.2. This secreted protein catalyzes the cleavage of angiotensin I into angiotensin 1-9, and angiotensin II into the vasodilator angiotensin 1-7. The organ- and cell-specific expression of this gene suggests that it may play a role in the regulation of cardiovascular and renal function, as well as fertility. In addition, the encoded protein is a functional receptor for the spike glycoprotein of the human coronaviruses SARS and HCoV-NL63.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 10 pg/mL

ACE2 ELISA Kit (Human) (OKCD07767)
OKCD07767 96 Wells
EUR 544
Description: Description of target: ACE2 belongs to the angiotensin-converting enzyme family of dipeptidyl carboxydipeptidases and has considerable homology to human angiotensin 1 converting enzyme. This secreted protein catalyzes the cleavage of angiotensin I into angiotensin 1-9, and angiotensin II into the vasodilator angiotensin 1-7. The organ- and cell-specific expression of this gene suggests that it may play a role in the regulation of cardiovascular and renal function, as well as fertility. In addition, the encoded protein is a functional receptor for the spike glycoprotein of the human coronaviruses SARS and HCoV-NL63. The protein encoded by this gene belongs to the angiotensin-converting enzyme family of dipeptidyl carboxydipeptidases and has considerable homology to human angiotensin 1 converting enzyme. This protein catalyzes the cleavage of angiotensin I into angiotensin 1-9. The organ- and cell-specific expression of this gene suggests that it may play a role in the regulation of cardiovascular and renal function, as well as fertility. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Entrez Gene record to access additional publications.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 6.4pg/mL

ACE2 ELISA Kit (Mouse) (OKCD07768)
OKCD07768 96 Wells
EUR 818
Description: Description of target: AngiotensinI-converting enzyme 2 (ACE 2) is a protein belongs to the angiotensin-converting enzyme family of dipeptidyl carboxydipeptidases and has considerable homology to human angiotensin 1 converting enzyme. By sequence similarity to a sequence in GenBank, this gene is mapped to Xp22.2. This secreted protein catalyzes the cleavage of angiotensin I into angiotensin 1-9, and angiotensin II into the vasodilator angiotensin 1-7. The organ- and cell-specific expression of this gene suggests that it may play a role in the regulation of cardiovascular and renal function, as well as fertility. In addition, the encoded protein is a functional receptor for the spike glycoprotein of the human coronaviruses SARS and HCoV-NL63.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 5.7pg/mL

ACE2 ELISA Kit (Rat) (OKCD07769)
OKCD07769 96 Wells
EUR 1001
Description: Description of target: enzyme peptidyl-dipeptidase; mouse homolog has a role in regulation of cardiac contractility and regulating Angiotensin 1 and 2 levels.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 0.31ng/mL

ACE2 ELISA Kit (Mouse) (OKEH06836)
OKEH06836 96 Wells
EUR 662
Description: Description of target: Carboxypeptidase which converts angiotensin I to angiotensin 1-9, a peptide of unknown function, and angiotensin II to angiotensin 1-7, a vasodilator. Also able to hydrolyze apelin-13 and dynorphin-13 with high efficiency. May be an important regulator of heart function. May have a protective role in acute lung injury.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.174 ng/mL

ACE2 Rabbit pAb
A12737-100ul 100 ul
EUR 308

ACE2 Rabbit pAb
A12737-200ul 200 ul
EUR 459

ACE2 Rabbit pAb
A12737-20ul 20 ul
EUR 183

ACE2 Rabbit pAb
A12737-50ul 50 ul
EUR 223

ACE2 Blocking Peptide
33R-3121 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ACE2 antibody, catalog no. 70R-7469

ACE2 Inhibitor, DX600
9687-100
EUR 175

ACE2 Inhibitor, DX600
9687-1000
EUR 865

ACE2 Inhibitor, DX600
9687-500
EUR 512

ACE2 (Middle) Antibody
abx022915-100ug 100 ug
EUR 746
  • Shipped within 5-10 working days.

ACE2 Blocking Peptide
20-abx061717
  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

ACE2 Blocking Peptide
AF5165-BP 1mg
EUR 195

ACE2 Conjugated Antibody
C36103 100ul
EUR 397

Polyclonal ACE2 Antibody
APR06331G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ACE2 . This antibody is tested and proven to work in the following applications:

Polyclonal ACE2 Antibody
APR06332G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ACE2 . This antibody is tested and proven to work in the following applications:

Polyclonal ACE2 Antibody
APR06333G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ACE2 . This antibody is tested and proven to work in the following applications:

Polyclonal ACE2 Antibody
APR06334G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ACE2 . This antibody is tested and proven to work in the following applications:

ACE2 cloning plasmid
CSB-CL866317HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2418
  • Sequence: ATGTCAAGCTCTTCCTGGCTCCTTCTCAGCCTTGTTGCTGTAACTGCTGCTCAGTCCACCATTGAGGAACAGGCCAAGACATTTTTGGACAAGTTTAACCACGAAGCCGAAGACCTGTTCTATCAAAGTTCACTTGCTTCTTGGAATTATAACACCAATATTACTGAAGAGAATG
  • Show more
Description: A cloning plasmid for the ACE2 gene.

ACE2 Rabbit pAb
A9454-100ul 100 ul
EUR 308

ACE2 Rabbit pAb
A9454-200ul 200 ul
EUR 459

ACE2 Rabbit pAb
A9454-20ul 20 ul Ask for price

ACE2 Rabbit pAb
A9454-50ul 50 ul Ask for price

ACE2 Rabbit mAb
A4612-100ul 100 ul
EUR 410

ACE2 Rabbit mAb
A4612-200ul 200 ul
EUR 571

ACE2 Rabbit mAb
A4612-20ul 20 ul
EUR 221

ACE2 Rabbit mAb
A4612-50ul 50 ul
EUR 287

ACE2 Polyclonal Antibody
ABP56008-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human ACE2
  • Applications tips:
Description: A polyclonal antibody for detection of ACE2 from Human, Mouse. This ACE2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ACE2

ACE2 Polyclonal Antibody
ABP56008-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human ACE2
  • Applications tips:
Description: A polyclonal antibody for detection of ACE2 from Human, Mouse. This ACE2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ACE2

ACE2 Polyclonal Antibody
ABP56008-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human ACE2
  • Applications tips:
Description: A polyclonal antibody for detection of ACE2 from Human, Mouse. This ACE2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ACE2

ACE2 Polyclonal Antibody
ES7007-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ACE2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

ACE2 Polyclonal Antibody
ES7007-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ACE2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

anti- ACE2 antibody
FNab00081 100µg
EUR 505.25
  • Recommended dilution: WB: 1:1000-1:10000
  • IP: 1:500-1:5000
  • Immunogen: angiotensin I converting enzyme(peptidyl-dipeptidase A) 2
  • Uniprot ID: Q9BYF1
  • Gene ID: 59272
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against ACE2

Anti-ACE2 antibody
PAab00081 100 ug
EUR 355

pCMV-SPORT6-ACE2
PVT14449 2 ug
EUR 495

Anti-ACE2 antibody
STJ111706 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the angiotensin-converting enzyme family of dipeptidyl carboxydipeptidases and has considerable homology to human angiotensin 1 converting enzyme. This secreted protein catalyzes the cleavage of angiotensin I into angiotensin 1-9, and angiotensin II into the vasodilator angiotensin 1-7. The organ- and cell-specific expression of this gene suggests that it may play a role in the regulation of cardiovascular and renal function, as well as fertility. In addition, the encoded protein is a functional receptor for the spike glycoprotein of the human coronaviruses SARS and HCoV-NL63.

Anti-ACE2 antibody
STJ114610 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the angiotensin-converting enzyme family of dipeptidyl carboxydipeptidases and has considerable homology to human angiotensin 1 converting enzyme. This secreted protein catalyzes the cleavage of angiotensin I into angiotensin 1-9, and angiotensin II into the vasodilator angiotensin 1-7. The organ- and cell-specific expression of this gene suggests that it may play a role in the regulation of cardiovascular and renal function, as well as fertility. In addition, the encoded protein is a functional receptor for the spike glycoprotein of the human coronaviruses SARS and HCoV-NL63.

Anti-ACE2 antibody
STJ91442 200 µl
EUR 197
Description: Rabbit polyclonal to ACE2.

Anti-ACE2 Antibody
A2072-100 100 µg
EUR 394

ACE2 Antibody, HRP conjugated
1-CSB-PA866317LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ACE2. Recognizes ACE2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ACE2 Antibody, FITC conjugated
1-CSB-PA866317LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ACE2. Recognizes ACE2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ACE2 Antibody, Biotin conjugated
1-CSB-PA866317LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ACE2. Recognizes ACE2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

ACE2 (C-Term) Antibody
abx022916-100ug 100 ug
EUR 878
  • Shipped within 5-10 working days.

ACE2 (N-Term) Antibody
abx022917-100ug 100 ug
EUR 801
  • Shipped within 5-10 working days.

ACE2 (SARS Receptor) Antibody
abx032686-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

ACE2 (SARS Receptor) Antibody
abx032686-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Rat ACE2 shRNA Plasmid
20-abx989155
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse ACE2 shRNA Plasmid
20-abx977106
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ACE2 shRNA Plasmid
20-abx961760
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pMD18-T-ACE2 Plasmid
PVTB00628 2 ug
EUR 356

ACE2 Recombinant Protein (Human)
RP036397 100 ug Ask for price

ACE2 Recombinant Protein (Mouse)
RP113765 100 ug Ask for price

ACE2 Recombinant Protein (Mouse)
RP113768 100 ug Ask for price

ACE2 Recombinant Protein (Rat)
RP188834 100 ug Ask for price

ACE2 ELISA Kit (Rat) : 96 Wells (OKEH01348)
OKEH01348 96 Wells
EUR 662
Description: Description of target: enzyme peptidyl-dipeptidase; mouse homolog has a role in regulation of cardiac contractility and regulating Angiotensin 1 and 2 levels ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.091 ng/mL

ACE2 ELISA Kit (Human) : 96 Wells (OKEH02626)
OKEH02626 96 Wells
EUR 662
Description: Description of target: The protein encoded by this gene belongs to the angiotensin-converting enzyme family of dipeptidyl carboxydipeptidases and has considerable homology to human angiotensin 1 converting enzyme. This secreted protein catalyzes the cleavage of angiotensin I into angiotensin 1-9, and angiotensin II into the vasodilator angiotensin 1-7. The organ- and cell-specific expression of this gene suggests that it may play a role in the regulation of cardiovascular and renal function, as well as fertility. In addition, the encoded protein is a functional receptor for the spike glycoprotein of the human coronaviruses SARS and HCoV-NL63.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.34 ng/mL

Monoclonal ACE2 Antibody, Clone: 881CT16.4.4
AMM02457G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human ACE2. The antibodies are raised in Mouse and are from clone 881CT16.4.4. This antibody is applicable in WB, E

Anti-ACE2 Rabbit Monoclonal Antibody
M00756 100ug/vial
EUR 397
Description: Rabbit Monoclonal ACE2 Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

Ace2 ORF Vector (Rat) (pORF)
ORF062946 1.0 ug DNA
EUR 506

ACE2 ORF Vector (Human) (pORF)
ORF012133 1.0 ug DNA
EUR 354

Ace2 ORF Vector (Mouse) (pORF)
ORF037923 1.0 ug DNA
EUR 506

Ace2 ORF Vector (Mouse) (pORF)
ORF037924 1.0 ug DNA
EUR 506

pECMV-Ace2-m-FLAG Plasmid
PVT15343 2 ug
EUR 325

Human Angiotensin converting enzyme 2, ACE2 ELISA Kit
CSB-E04489h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Angiotensin converting enzyme 2, ACE2 in samples from serum, plasma, cell culture supernates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Angiotensin converting enzyme 2, ACE2 ELISA Kit
1-CSB-E04489h
  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Angiotensin converting enzyme 2, ACE2 in samples from serum, plasma, cell culture supernates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Angiotensin converting enzyme 2, ACE2 ELISA Kit
CSB-E04489h-96T 96T Ask for price
  • Sample Volume: 50-100 ul
  • Detection Wavelength: 450 nm
  • Research Area:Immunology
  • Assay Principle:Quantitative
  • Measurement:Sandwich
Description: ACE related carboxypeptidase ELISA Kit has high sensitivity and excellent specificity for detection ofhuman ACE2. No significant cross-reactivity or interference between humanACE2and analogues was observed

Rat Ace2/ Angiotensin-converting enzyme 2 ELISA Kit
E0018Ra 1 Kit
EUR 571

Human ACE2/ Angiotensin-converting enzyme 2 ELISA Kit
E0023Hu 1 Kit
EUR 571

Human ACE2(Angiotensin-converting enzyme 2) ELISA Kit
EH0027 96T
EUR 524.1
  • Detection range: 0.391-25 ng/ml
  • Uniprot ID: Q9BYF1
  • Alias: ACEH/ACEII
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.234 ng/ml

Human Angiotensin- converting enzyme 2, ACE2 ELISA KIT
ELI-06049h 96 Tests
EUR 824

Mouse Angiotensin- converting enzyme 2, Ace2 ELISA KIT
ELI-06050m 96 Tests
EUR 865

Bovine Angiotensin- converting enzyme 2, ACE2 ELISA KIT
ELI-06052b 96 Tests
EUR 928

Rat Angiotensin converting enzyme 2, ACE2 ELISA Kit
CSB-E14308r-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Angiotensin converting enzyme 2, ACE2 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rat Angiotensin converting enzyme 2, ACE2 ELISA Kit
1-CSB-E14308r
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Angiotensin converting enzyme 2, ACE2 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Angiotensin converting enzyme 2(ACE2)ELISA Kit
CSB-E17204m-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Angiotensin converting enzyme 2 (ACE2) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Angiotensin converting enzyme 2(ACE2)ELISA Kit
1-CSB-E17204m
  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Angiotensin converting enzyme 2(ACE2) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat Ace2(Angiotensin-converting enzyme 2) ELISA Kit
ER0609 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q5EGZ1
  • Alias: Ace2/ACE-related carboxypeptidase/
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.094 ng/ml

Rat Angiotensin converting enzyme 2(ACE2)ELISA Kit
GA-E0821RT-48T 48T
EUR 317

Rat Angiotensin converting enzyme 2(ACE2)ELISA Kit
GA-E0821RT-96T 96T
EUR 496

Rat Angiotensin converting enzyme 2(ACE2)ELISA Kit
QY-E10831 96T
EUR 361

Mouse Angiotensin converting enzyme 2(ACE2)ELISA Kit
QY-E20096 96T
EUR 361

Ace2 ELISA Kit| Rat Angiotensin-converting enzyme 2 ELISA Kit
EF017429 96 Tests
EUR 689

Rabbit anti-Human ACE2 Polyclonal antibody
1-CSB-PA001150GA01HU
  • Ask for price
  • Ask for price
  • 150ul
  • 50ul
  • Purification Method: Antigen Affinity purified
  • Concentration: It differs from different batches. Please contact us to confirm it.
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3
  • Tested Applications: ELISA,WB
Description: Human ACE2 Polyclonal antibody is raised in rabbit, and it is tested for ELISA and WB.

Rabbit anti-Human ACE2 Polyclonal antibody
1-CSB-PA866317LA01HU
  • Ask for price
  • Ask for price
  • 100ug
  • 50ug
  • Purification Method: >95%, Protein G purified
  • Concentration: It differs from different batches. Please contact us to confirm it.
  • Buffer: Preservative: 0.03% Proclin 300: Constituents: 50% Glycerol, 0.01M PBS, PH 7.4
  • Form: Liquid
  • Tested Applications:
  • Show more
Description: Human ACE2 Polyclonal antibody is raised in rabbit, and it is tested for ELISA, IHC and IF.

Polyclonal ACE2 / ACE-2 Antibody (Internal)
APR02552G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ACE2 / ACE-2 (Internal). This antibody is tested and proven to work in the following applications:

Polyclonal ACE2 (SARS Receptor) Antibody (Center)
APR05696G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ACE2 (SARS Receptor) (Center). This antibody is tested and proven to work in the following applications:

Polyclonal ACE2 / ACE-2 Antibody (Internal)
APR02229G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ACE2 / ACE-2 (Internal). This antibody is tested and proven to work in the following applications:

Angiotensin-Converting Enzyme 2 (ACE2) Antibody
20-abx313823
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ace2 sgRNA CRISPR Lentivector set (Rat)
K7372001 3 x 1.0 ug
EUR 339

ACE2 sgRNA CRISPR Lentivector set (Human)
K0028501 3 x 1.0 ug
EUR 339

Ace2 sgRNA CRISPR Lentivector set (Mouse)
K4049101 3 x 1.0 ug
EUR 339

ELISA kit for Human ACE2 (Angiotensin ? Converting Enzyme 2)
E-EL-H0281 1 plate of 96 wells
EUR 534
  • Gentaur's ACE2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human ACE2. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human ACE2 (Angiotensin ? Converting Enzyme 2) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Rat ACE2 (Angiotensin ? Converting Enzyme 2)
E-EL-R2453 1 plate of 96 wells
EUR 534
  • Gentaur's ACE2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat ACE2. Standards or samples are added to the micro ELISA plate wells and combined with the
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat ACE2 (Angiotensin ? Converting Enzyme 2) in samples from Serum, Plasma, Cell supernatant

Human Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit
abx055274-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit
20-abx150520
  • EUR 5311.00
  • EUR 2837.00
  • EUR 668.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit
20-abx153587
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit
20-abx155132
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit
abx256584-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit
abx250166-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Monkey Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit
abx360310-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit
abx361230-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit
abx363214-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit
abx356710-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rat Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit
abx573465-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit
abx574723-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit
abx576063-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Cow Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit
20-abx518713
  • EUR 7504.00
  • EUR 3996.00
  • EUR 926.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

ELISA kit for Rat Angiotensin converting enzyme 2 (ACE2)
KTE100322-48T 48T
EUR 332
  • ACE2 is an exopeptidase that catalyses the conversion of angiotensin I to the nonapeptide angiotensin ,or the conversion of angiotensin II to angiotensin. ACE 2 has direct effects on cardiac function, and is expressed predominantly in vascular endoth
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Angiotensin converting enzyme 2 (ACE2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Angiotensin converting enzyme 2 (ACE2)
KTE100322-5platesof96wells 5 plates of 96 wells
EUR 2115
  • ACE2 is an exopeptidase that catalyses the conversion of angiotensin I to the nonapeptide angiotensin ,or the conversion of angiotensin II to angiotensin. ACE 2 has direct effects on cardiac function, and is expressed predominantly in vascular endoth
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Angiotensin converting enzyme 2 (ACE2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Angiotensin converting enzyme 2 (ACE2)
KTE100322-96T 96T
EUR 539
  • ACE2 is an exopeptidase that catalyses the conversion of angiotensin I to the nonapeptide angiotensin ,or the conversion of angiotensin II to angiotensin. ACE 2 has direct effects on cardiac function, and is expressed predominantly in vascular endoth
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Angiotensin converting enzyme 2 (ACE2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Angiotensin converting enzyme 2 (ACE2)
KTE60876-48T 48T
EUR 354
  • ACE2 is an exopeptidase that catalyses the conversion of angiotensin I to the nonapeptide angiotensin ,or the conversion of angiotensin II to angiotensin. ACE 2 has direct effects on cardiac function, and is expressed predominantly in vascular endoth
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Angiotensin converting enzyme 2 (ACE2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Angiotensin converting enzyme 2 (ACE2)
KTE60876-5platesof96wells 5 plates of 96 wells
EUR 2252
  • ACE2 is an exopeptidase that catalyses the conversion of angiotensin I to the nonapeptide angiotensin ,or the conversion of angiotensin II to angiotensin. ACE 2 has direct effects on cardiac function, and is expressed predominantly in vascular endoth
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Angiotensin converting enzyme 2 (ACE2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Angiotensin converting enzyme 2 (ACE2)
KTE60876-96T 96T
EUR 572
  • ACE2 is an exopeptidase that catalyses the conversion of angiotensin I to the nonapeptide angiotensin ,or the conversion of angiotensin II to angiotensin. ACE 2 has direct effects on cardiac function, and is expressed predominantly in vascular endoth
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Angiotensin converting enzyme 2 (ACE2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Canine Angiotensin-converting enzyme 2 (ACE2)
KTE20103-48T 48T
EUR 354
  • ACE2 is an exopeptidase that catalyses the conversion of angiotensin I to the nonapeptide angiotensin ,or the conversion of angiotensin II to angiotensin. ACE 2 has direct effects on cardiac function, and is expressed predominantly in vascular endoth
  • Show more
Description: Quantitative sandwich ELISA for measuring Canine Angiotensin-converting enzyme 2 (ACE2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Canine Angiotensin-converting enzyme 2 (ACE2)
KTE20103-5platesof96wells 5 plates of 96 wells
EUR 2252
  • ACE2 is an exopeptidase that catalyses the conversion of angiotensin I to the nonapeptide angiotensin ,or the conversion of angiotensin II to angiotensin. ACE 2 has direct effects on cardiac function, and is expressed predominantly in vascular endoth
  • Show more
Description: Quantitative sandwich ELISA for measuring Canine Angiotensin-converting enzyme 2 (ACE2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Canine Angiotensin-converting enzyme 2 (ACE2)
KTE20103-96T 96T
EUR 572
  • ACE2 is an exopeptidase that catalyses the conversion of angiotensin I to the nonapeptide angiotensin ,or the conversion of angiotensin II to angiotensin. ACE 2 has direct effects on cardiac function, and is expressed predominantly in vascular endoth
  • Show more
Description: Quantitative sandwich ELISA for measuring Canine Angiotensin-converting enzyme 2 (ACE2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Angiotensin converting enzyme 2 (ACE2)
KTE70538-48T 48T
EUR 332
  • ACE2 is an exopeptidase that catalyses the conversion of angiotensin I to the nonapeptide angiotensin ,or the conversion of angiotensin II to angiotensin. ACE 2 has direct effects on cardiac function, and is expressed predominantly in vascular endoth
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Angiotensin converting enzyme 2 (ACE2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Angiotensin converting enzyme 2 (ACE2)
KTE70538-5platesof96wells 5 plates of 96 wells
EUR 2115
  • ACE2 is an exopeptidase that catalyses the conversion of angiotensin I to the nonapeptide angiotensin ,or the conversion of angiotensin II to angiotensin. ACE 2 has direct effects on cardiac function, and is expressed predominantly in vascular endoth
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Angiotensin converting enzyme 2 (ACE2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Angiotensin converting enzyme 2 (ACE2)
KTE70538-96T 96T
EUR 539
  • ACE2 is an exopeptidase that catalyses the conversion of angiotensin I to the nonapeptide angiotensin ,or the conversion of angiotensin II to angiotensin. ACE 2 has direct effects on cardiac function, and is expressed predominantly in vascular endoth
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Angiotensin converting enzyme 2 (ACE2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Angiotensin I Converting Enzyme 2 ELISA Kit (ACE2)
RK00796 96 Tests
EUR 521

Human Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit
SEB886Hu-10x96wellstestplate 10x96-wells test plate
EUR 3023.26
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Angiotensin I Converting Enzyme 2 (ACE2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-As
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Angiotensin I Converting Enzyme 2 (ACE2) in serum, plasma, and other biological fluids.

Human Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit
SEB886Hu-1x48wellstestplate 1x48-wells test plate
EUR 336.62
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Angiotensin I Converting Enzyme 2 (ACE2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-As
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Angiotensin I Converting Enzyme 2 (ACE2) in serum, plasma, and other biological fluids.

Human Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit
SEB886Hu-1x96wellstestplate 1x96-wells test plate
EUR 438.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Angiotensin I Converting Enzyme 2 (ACE2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-As
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Angiotensin I Converting Enzyme 2 (ACE2) in serum, plasma, and other biological fluids.

Human Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit
SEB886Hu-5x96wellstestplate 5x96-wells test plate
EUR 1671.14
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Angiotensin I Converting Enzyme 2 (ACE2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-As
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Angiotensin I Converting Enzyme 2 (ACE2) in serum, plasma, and other biological fluids.

Human Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit
4-SEB886Hu
  • EUR 3074.00
  • EUR 1622.00
  • EUR 439.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Angiotensin I Converting Enzyme 2 elisa. Alternative names of the recognized antigen: ACEH
  • ACEII
  • ACE-II
  • Peptidyl-Dipeptidase A
  • ACE-related carboxypeptidase
  • Angiotensin-converting enzyme homolog
  • Metalloprotease MPROT15
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Angiotensin I Converting Enzyme 2 (ACE2) in samples from serum, plasma, and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit
SEB886Mu-10x96wellstestplate 10x96-wells test plate
EUR 4626.78
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Angiotensin I Converting Enzyme 2 (ACE2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-As
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Angiotensin I Converting Enzyme 2 (ACE2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit
SEB886Mu-1x48wellstestplate 1x48-wells test plate
EUR 468.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Angiotensin I Converting Enzyme 2 (ACE2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-As
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Angiotensin I Converting Enzyme 2 (ACE2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit
SEB886Mu-1x96wellstestplate 1x96-wells test plate
EUR 626.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Angiotensin I Converting Enzyme 2 (ACE2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-As
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Angiotensin I Converting Enzyme 2 (ACE2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit
SEB886Mu-5x96wellstestplate 5x96-wells test plate
EUR 2520.06
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Angiotensin I Converting Enzyme 2 (ACE2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-As
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Angiotensin I Converting Enzyme 2 (ACE2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Angiotensin I Converting Enzyme 2 (ACE2) ELISA Kit
4-SEB886Mu
  • EUR 4677.00
  • EUR 2471.00
  • EUR 627.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Angiotensin I Converting Enzyme 2 elisa. Alternative names of the recognized antigen: ACEH
  • ACEII
  • ACE-II
  • Peptidyl-Dipeptidase A
  • ACE-related carboxypeptidase
  • Angiotensin-converting enzyme homolog
  • Metalloprotease MPROT15
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Angiotensin I Converting Enzyme 2 (ACE2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.