Circulating Lengthy Non-Coding RNA GAS5 Is Overexpressed in Serum from Osteoporotic Sufferers

Epitranscriptomic regulation by m ⁶ A RNA methylation in mind growth and ailments

 

• Mobile RNAs are pervasively tagged with numerous chemical moieties, collectively known as epitranscriptomic modifications. The methylation of adenosine at N⁶place generates N⁶-methyladenosine (m⁶A), which is essentially the most ample and reversible epitranscriptomic modification in mammals.
• The m⁶A signaling is mediated by a devoted set of proteins comprised of writers, erasers, and readers. Opposite to the activation-repression binary view of gene regulation, rising proof means that the m⁶A methylation controls a number of elements of mRNA metabolism, akin to splicing, export, stability, translation, and degradation, culminating within the fine-tuning of gene expression.
• Mind exhibits the best abundance of m⁶A methylation within the physique, which is developmentally altered. Inside the mind, m⁶A methylation is biased towards neuronal transcripts and delicate to neuronal exercise. In a wholesome mind, m⁶A maintains a number of developmental and physiological processes akin to neurogenesis, axonal development, synaptic plasticity, circadian rhythm, cognitive perform, and stress response. The m⁶A imbalance contributes to the pathogenesis of acute and continual CNS insults, mind most cancers, and neuropsychiatric problems.

 

• This overview mentioned the molecular mechanisms of m⁶A regulation and its implication within the developmental, physiological, and pathological processes of the mind.

 

GNAS Complex Locus (GNAS) Antibody
20-abx214658	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Gnas Complex Locus (GNAS) Antibody
20-abx112824	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

GNAS Complex Locus (GNAS) Antibody
20-abx338380	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

GNAS antibody
70R-1643	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal GNAS antibody raised against the N terminal of GNAS

GNAS antibody
70R-1651	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal GNAS antibody raised against the C terminal of GNAS

GNAS antibody
70R-1652	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal GNAS antibody raised against the N terminal of GNAS

GNAS antibody
70R-12940	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal GNAS antibody

GNAS antibody
70R-13520	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal GNAS antibody

GNAS antibody
70R-21619	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal GNAS antibody

GNAS Antibody
32899-100ul	SAB	100ul	EUR 252

GNAS antibody
38452-100ul	SAB	100ul	EUR 252

GNAS Antibody
1-CSB-PA147947	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

GNAS Antibody
DF7068	Affbiotech	200ul	EUR 304
Description: GNAS Antibody detects endogenous levels of total GNAS.

GNAS Antibody
DF7388	Affbiotech	200ul	EUR 304
Description: GNAS Antibody detects endogenous levels of total GNAS.

GNAS Antibody
1-CSB-PA307619LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:500-1:1000, IF:1:200-1:500

GNAS Antibody
1-CSB-PA352389LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

GNAS Antibody
1-CSB-PA247539	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:200-1:1000, IHC:1:25-1:100

GNAS antibody
70R-5756	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal GNAS antibody raised against the N terminal of GNAS

GNAS Antibody
1-CSB-PA009596GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

GNAS Antibody
ABD7068	Lifescience Market	100 ug	EUR 438

GNAS Antibody
ABD7388	Lifescience Market	100 ug	EUR 438

GNAS Complex Locus (GNAS) Antibody (HRP)
20-abx337231	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

GNAS Complex Locus (GNAS) Antibody (FITC)
20-abx337232	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

GNAS Complex Locus (GNAS) Antibody (Biotin)
20-abx337233	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

GNAS complex locus (GNAS) polyclonal antibody
ABP-PAB-11314	Allele Biotech	100 ug	Ask for price
Product line: Miscellaneous Brand:

GNAS Conjugated Antibody
C32899	SAB	100ul	EUR 397

NESP55,GNAS Antibody
abx235663-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

GNAS Antibody (HRP)
20-abx306647	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

GNAS Antibody (FITC)
20-abx306648	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

GNAS Antibody (Biotin)
20-abx306649	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

GNAS Polyclonal Antibody
A68803	EpiGentek	100 ?g	EUR 628.55
Description: Ask the seller for details

GNAS Polyclonal Antibody
A64422	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

anti- GNAS antibody
FNab03536	FN Test	100µg	EUR 505.25
Immunogen: GNAS complex locus Uniprot ID: O95467 Gene ID: 2778 Research Area: Neuroscience, Cancer, Immunology, Signal Transduction
Description: Antibody raised against GNAS

Anti-GNAS antibody
PAab03536	Lifescience Market	100 ug	EUR 355

Anti-GNAS antibody
STJ27492	St John's Laboratory	100 µl	EUR 277
Description: This locus has a highly complex imprinted expression pattern. It gives rise to maternally, paternally, and biallelically expressed transcripts that are derived from four alternative promoters and 5' exons. Some transcripts contain a differentially methylated region (DMR) at their 5' exons, and this DMR is commonly found in imprinted genes and correlates with transcript expression. An antisense transcript is produced from an overlapping locus on the opposite strand. One of the transcripts produced from this locus, and the antisense transcript, are paternally expressed noncoding RNAs, and may regulate imprinting in this region. In addition, one of the transcripts contains a second overlapping ORF, which encodes a structurally unrelated protein - Alex. Alternative splicing of downstream exons is also observed, which results in different forms of the stimulatory G-protein alpha subunit, a key element of the classical signal transduction pathway linking receptor-ligand interactions with the activation of adenylyl cyclase and a variety of cellular reponses. Multiple transcript variants encoding different isoforms have been found for this gene. Mutations in this gene result in pseudohypoparathyroidism type 1a, pseudohypoparathyroidism type 1b, Albright hereditary osteodystrophy, pseudopseudohypoparathyroidism, McCune-Albright syndrome, progressive osseus heteroplasia, polyostotic fibrous dysplasia of bone, and some pituitary tumors.

Anti-GNAS antibody
STJ23816	St John's Laboratory	100 µl	EUR 277
Description: This locus has a highly complex imprinted expression pattern. It gives rise to maternally, paternally, and biallelically expressed transcripts that are derived from four alternative promoters and 5' exons. Some transcripts contain a differentially methylated region (DMR) at their 5' exons, and this DMR is commonly found in imprinted genes and correlates with transcript expression. An antisense transcript is produced from an overlapping locus on the opposite strand. One of the transcripts produced from this locus, and the antisense transcript, are paternally expressed noncoding RNAs, and may regulate imprinting in this region. In addition, one of the transcripts contains a second overlapping ORF, which encodes a structurally unrelated protein - Alex. Alternative splicing of downstream exons is also observed, which results in different forms of the stimulatory G-protein alpha subunit, a key element of the classical signal transduction pathway linking receptor-ligand interactions with the activation of adenylyl cyclase and a variety of cellular reponses. Multiple transcript variants encoding different isoforms have been found for this gene. Mutations in this gene result in pseudohypoparathyroidism type 1a, pseudohypoparathyroidism type 1b, Albright hereditary osteodystrophy, pseudopseudohypoparathyroidism, McCune-Albright syndrome, progressive osseus heteroplasia, polyostotic fibrous dysplasia of bone, and some pituitary tumors.

Anti-GNAS antibody
STJ72252	St John's Laboratory	100 µg	EUR 359

Gnas/ Rat Gnas ELISA Kit
ELI-12714r	Lifescience Market	96 Tests	EUR 886

Gnas/ Rat Gnas ELISA Kit
ELI-27931r	Lifescience Market	96 Tests	EUR 886

Gnas/ Rat Gnas ELISA Kit
ELI-35065r	Lifescience Market	96 Tests	EUR 886

Gnas/ Rat Gnas ELISA Kit
ELI-47242r	Lifescience Market	96 Tests	EUR 886

GNAS siRNA
20-abx900009	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GNAS siRNA
20-abx900030	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GNAS siRNA
20-abx918154	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GNAS siRNA
20-abx918155	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GNAS siRNA
20-abx918156	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GNAS siRNA
20-abx918157	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GNAS siRNA
20-abx918158	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GNAS siRNA
20-abx918159	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GNAS siRNA
20-abx918160	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GNAS siRNA
20-abx918161	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

pBluescriptR-GNAS
PVT17793	Lifescience Market	2 ug	EUR 231

Polyclonal GNAS Antibody (Center)
APR05815G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNAS (Center). This antibody is tested and proven to work in the following applications:

GNAS Antibody, Biotin conjugated
1-CSB-PA352389LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GNAS Antibody, HRP conjugated
1-CSB-PA307619LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GNAS Antibody, FITC conjugated
1-CSB-PA307619LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GNAS Antibody, Biotin conjugated
1-CSB-PA307619LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GNAS Antibody, HRP conjugated
1-CSB-PA352389LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GNAS Antibody, FITC conjugated
1-CSB-PA352389LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

anti- NESP55,GNAS antibody
FNab05663	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:1000-1:4000 IHC: 1:50-1：500 Immunogen: GNAS complex locus Uniprot ID: O95467 Research Area: cancer, Metabolism
Description: Antibody raised against NESP55,GNAS

Polyclonal GNAS Antibody (C-term)
APR04328G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNAS (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal GNAS Antibody (internal region)
APG00677G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human GNAS (internal region). This antibody is tested and proven to work in the following applications:

Polyclonal GNAS Antibody (aa385-394)
APR02185G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNAS (aa385-394). This antibody is tested and proven to work in the following applications:

Monoclonal GNAS Antibody, Clone: 7G6G5
AMM03034G	Leading Biology	0.1ml	EUR 528
Description: A Monoclonal antibody against Human GNAS. The antibodies are raised in Mouse and are from clone 7G6G5. This antibody is applicable in WB and IHC, FC, ICC, E

Monoclonal GNAS Antibody, Clone: 2A2B7
AMM03035G	Leading Biology	0.1ml	EUR 528
Description: A Monoclonal antibody against Human GNAS. The antibodies are raised in Mouse and are from clone 2A2B7. This antibody is applicable in WB and IHC, FC, ICC, E

Polyclonal GNAS Antibody (N-Term)
AMM04827G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNAS (N-Term). This antibody is tested and proven to work in the following applications:

GNAS Polyclonal Antibody, HRP Conjugated
A68804	EpiGentek	100 ?g	EUR 628.55
Description: The best epigenetics products

GNAS Polyclonal Antibody, FITC Conjugated
A68805	EpiGentek	100 ?g	EUR 628.55
Description: kits suitable for this type of research

GNAS Polyclonal Antibody, Biotin Conjugated
A68806	EpiGentek	100 ?g	EUR 628.55
Description: fast delivery possible

GNAS Polyclonal Antibody, HRP Conjugated
A64423	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

GNAS Polyclonal Antibody, FITC Conjugated
A64424	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

GNAS Polyclonal Antibody, Biotin Conjugated
A64425	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

GNAS Blocking Peptide
33R-10097	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAS antibody, catalog no. 70R-1651

GNAS Blocking Peptide
33R-8471	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAS antibody, catalog no. 70R-1652

GNAS Blocking Peptide
33R-9925	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAS antibody, catalog no. 70R-5756

GNAS Blocking Peptide
33R-6814	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAS antibody, catalog no. 70R-1643

GNAS Blocking Peptide
DF7068-BP	Affbiotech	1mg	EUR 195

GNAS Blocking Peptide
DF7388-BP	Affbiotech	1mg	EUR 195

GNAS cloning plasmid
CSB-CL009596HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1185 Sequence: atgggctgcctcgggaacagtaagaccgaggaccagcgcaacgaggagaaggcgcagcgtgaggccaacaaaaagatcgagaagcagctgcagaaggacaagcaggtctaccgggccacgcaccgcctgctgctgctgggtgctggagaatctggtaaaagcaccattgtgaagc Show more
Description: A cloning plasmid for the GNAS gene.

GNAS cloning plasmid
CSB-CL009596HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1188 Sequence: atgggctgcctcgggaacagtaagaccgaggaccagcgcaacgaggagaaggcgcagcgtgaggccaacaaaaagatcgagaagcagctgcagaaggacaagcaggtctaccgggccacgcaccgcctgctgctgctgggtgctggagaatctggtaaaagcaccattgtgaagc Show more
Description: A cloning plasmid for the GNAS gene.

GNAS Rabbit pAb
A5546-100ul	Abclonal	100 ul	EUR 308

GNAS Rabbit pAb
A5546-200ul	Abclonal	200 ul	EUR 459

GNAS Rabbit pAb
A5546-20ul	Abclonal	20 ul	EUR 183

GNAS Rabbit pAb
A5546-50ul	Abclonal	50 ul	EUR 223

GNAS Rabbit pAb
A2732-100ul	Abclonal	100 ul	EUR 308

GNAS Rabbit pAb
A2732-200ul	Abclonal	200 ul	EUR 459

GNAS Rabbit pAb
A2732-20ul	Abclonal	20 ul	EUR 183

GNAS Rabbit pAb
A2732-50ul	Abclonal	50 ul	EUR 223

Recombinant human GNAS
P1012	FN Test	100ug	Ask for price
Uniprot ID: O95467 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human GNAS

pSV40- Gnas- m
PVT11671	Lifescience Market	2 ug	EUR 273

Human GNAS ELISA KIT
ELI-12712h	Lifescience Market	96 Tests	EUR 824

Mouse Gnas ELISA KIT
ELI-12713m	Lifescience Market	96 Tests	EUR 865

Canine GNAS ELISA KIT
ELI-27250d	Lifescience Market	96 Tests	EUR 928

GNAS ELISA KIT|Human
EF009911	Lifescience Market	96 Tests	EUR 689

Rat GNAS shRNA Plasmid
20-abx984695	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat GNAS shRNA Plasmid
20-abx984696	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human GNAS shRNA Plasmid
20-abx951847	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human GNAS shRNA Plasmid
20-abx951848	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human GNAS shRNA Plasmid
20-abx951849	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RNA-Binding Proteins in Most cancers: Practical and Therapeutic Views

 

RNA-binding proteins (RBPs) crucially regulate gene expression by post-transcriptional regulation, akin to by modulating microRNA (miRNA) processing and the choice splicing, different polyadenylation, subcellular localization, stability, and translation of RNAs. Greater than 1500 RBPs have been recognized so far, and plenty of of them are recognized to be deregulated in most cancers. Alterations within the expression and localization of RBPs can affect the expression ranges of oncogenes, tumor-suppressor genes, and genome stability-related genes.

RBP-mediated gene regulation can result in numerous cancer-related mobile phenotypes, akin to proliferation, apoptosis, angiogenesis, senescence, and epithelial-mesenchymal transition (EMT)/invasion/metastasis. This regulation can be related to most cancers prognosis.

Thus, RBPs could be potential targets for the event of therapeutics for the most cancers therapy. On this overview, we describe the molecular features of RBPs, their roles in cancer-related mobile phenotypes, and numerous approaches that could be used to focus on RBPs for most cancers therapy.

 

Circulating Lengthy Non-Coding RNA GAS5 Is Overexpressed in Serum from Osteoporotic Sufferers and Is Related to Elevated Danger of Bone Fragility

 

Osteoporosis (OP) is a multifactorial dysfunction through which environmental elements together with genetic variants and epigenetic mechanisms have been implicated. Lengthy non-coding RNAs (lncRNAs) have just lately emerged as essential regulators of bone metabolism and OP aetiology.

On this research, we analyzed the expression degree and the genetic affiliation of lncRNA GAS5 in OP sufferers in comparison with controls. Quantitative RT-PCR evaluation of GAS5 was carried out on the serum of 56 OP sufferers and 28 wholesome people. OP topics had been divided into three teams of research: 29 with fragility fractures of lumbar backbone (OP_VF), 14 with fragility fractures of femoral neck (OP_FF) and 13 with out fractures (OP_WF). Genotyping of the rs145204276 insertion/deletion polymorphism has additionally been carried out by Restriction fragment size polymorphism (RFLP) and direct sequencing analyses.

Expression of circulating GAS5 is considerably elevated in OP sufferers in comparison with controls (p < 0.01), with a statistically greater significance in fractured OP people vs. wholesome topics (p < 0.001). No statistically important change was present in feminine OP sufferers; conversely, GAS5 is upregulated within the subgroup of fractured OP ladies sera (p < 0.01) and in all OP males (p < 0.05). Moreover, a direct correlation between GAS5 expression degree and parathyroid hormone (PTH) focus was present in OP sufferers (r = 0.2930; p = 0.0389).

Genetic evaluation of rs145204276 revealed that the deletion allele was correlated with the next expression of GAS5 in OP sufferers (0.22 ± 0.02 vs. 0.15 ± 0.01, ** p < 0.01). Our outcomes recommend circulating GAS5 as a putative biomarker for the prognosis and prognosis of OP and OP-related fractures.

 

Rat Sex Determining Region Y Box Protein 2 (SOX2) ELISA Kit
RD-SOX2-Ra-96Tests	Reddot Biotech	96 Tests	EUR 709

Rat Sex Determining Region Y Box Protein 2 (SOX2) ELISA Kit
RDR-SOX2-Ra-48Tests	Reddot Biotech	48 Tests	EUR 534

Rat Sex Determining Region Y Box Protein 2 (SOX2) ELISA Kit
RDR-SOX2-Ra-96Tests	Reddot Biotech	96 Tests	EUR 742

SOX2 Antibody
25044-100ul	SAB	100ul	EUR 390

Sox2 antibody
20R-1751	Fitzgerald	100 ug	EUR 673
Description: Rabbit polyclonal Sox2 antibody

SOX2 antibody
20R-2500	Fitzgerald	50 ug	EUR 281
Description: Rabbit polyclonal SOX2 antibody

SOX2 Antibody
21425-100ul	SAB	100ul	EUR 252

SOX2 Antibody
21425-50ul	SAB	50ul	EUR 187

SOX2 Antibody
31128-100ul	SAB	100ul	EUR 252

SOX2 Antibody
31128-50ul	SAB	50ul	EUR 187

SOX2 antibody
70R-12166	Fitzgerald	100 ug	EUR 403
Description: Rabbit polyclonal SOX2 antibody

SOX2 antibody
70R-20460	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal SOX2 antibody

SOX2 Antibody
48128-100ul	SAB	100ul	EUR 333

SOX2 Antibody
48128-50ul	SAB	50ul	EUR 239

SOX2 antibody
38134-100ul	SAB	100ul	EUR 252

SOX2 antibody
10R-11127	Fitzgerald	100 ug	EUR 349
Description: Mouse monoclonal SOX2 antibody

SOX2 Antibody
43142-100ul	SAB	100ul	EUR 252

SOX2 Antibody
CSB-PA982860-	Cusabio		EUR 335
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo Show more
Description: A polyclonal antibody against SOX2. Recognizes SOX2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

SOX2 Antibody
CSB-PA982860-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo Show more
Description: A polyclonal antibody against SOX2. Recognizes SOX2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

SOX2 Antibody
1-CSB-PA698932	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SOX2. Recognizes SOX2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

SOX2 Antibody
DF6109	Affbiotech	200ul	EUR 304
Description: SOX2 Antibody detects endogenous levels of total SOX2.

SOX2 Antibody
1-CSB-PA588368	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SOX2. Recognizes SOX2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:15-1:50

SOX2 Antibody
1-CSB-PA16539A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SOX2. Recognizes SOX2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

Sox2 antibody
70R-SR013	Fitzgerald	100 ug	EUR 300
Description: Affinity purified Rabbit polyclonal Sox2 antibody

SOX2 antibody
70R-33158	Fitzgerald	100 ug	EUR 435
Description: Rabbit polyclonal SOX2 antibody

SOX2 antibody
70R-33160	Fitzgerald	100 ug	EUR 435
Description: Rabbit polyclonal SOX2 antibody

SOX2 Antibody
AF4010	Affbiotech	200ul	EUR 376
Description: The antibody detects endogenous level of total SOX2 protein.

SOX2 Antibody
AF5140	Affbiotech	200ul	EUR 304
Description: SOX2 Antibody detects endogenous levels of total SOX2.

SOX2 Antibody
BF0481	Affbiotech	200ul	EUR 376
Description: SOX2 antibody detects endogenous levels of total SOX2.

SOX2 Antibody
1-CSB-PA022426GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SOX2. Recognizes SOX2 from Human, Mouse, Rat, Zebrafish. This antibody is Unconjugated. Tested in the following application: ELISA, IF

sox2 Antibody
AF7950	Affbiotech	200ul	EUR 376
Description: sox2 Antibody detects endogenous levels of sox2.

SOX2 Antibody
ABD6109	Lifescience Market	100 ug	EUR 438

SOX2 Antibody
ABF4010	Lifescience Market	100 ug	EUR 438

SOX2 Antibody
ABF5140	Lifescience Market	100 ug	EUR 438

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNUM1791-50	Biotium	50uL	EUR 395
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791), 1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNUM1792-50	Biotium	50uL	EUR 395
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792), 1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNUB1791-100	Biotium	100uL	EUR 209
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791), Concentration: 0.2mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNUB1791-500	Biotium	500uL	EUR 458
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791), Concentration: 0.2mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNUB1792-100	Biotium	100uL	EUR 209
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792), Concentration: 0.2mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNUB1792-500	Biotium	500uL	EUR 458
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792), Concentration: 0.2mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC551791-100	Biotium	100uL	EUR 199
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF555 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC551791-500	Biotium	500uL	EUR 544
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF555 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC551792-100	Biotium	100uL	EUR 199
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF555 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC551792-500	Biotium	500uL	EUR 544
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF555 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC611791-100	Biotium	100uL	EUR 199
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF660R conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC611791-500	Biotium	500uL	EUR 544
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF660R conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC611792-100	Biotium	100uL	EUR 199
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF660R conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC611792-500	Biotium	500uL	EUR 544
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF660R conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC471791-100	Biotium	100uL	EUR 199
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF647 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC471791-500	Biotium	500uL	EUR 544
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF647 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC471792-100	Biotium	100uL	EUR 199
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF647 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC471792-500	Biotium	500uL	EUR 544
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF647 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC051791-100	Biotium	100uL	EUR 199
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF405M conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC051791-500	Biotium	500uL	EUR 544
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF405M conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC051792-100	Biotium	100uL	EUR 199
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF405M conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC051792-500	Biotium	500uL	EUR 544
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF405M conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC401791-100	Biotium	100uL	EUR 199
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF640R conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC401791-500	Biotium	500uL	EUR 544
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF640R conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC401792-100	Biotium	100uL	EUR 199
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF640R conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC401792-500	Biotium	500uL	EUR 544
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF640R conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC431791-100	Biotium	100uL	EUR 199
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF543 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC431791-500	Biotium	500uL	EUR 544
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF543 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC431792-100	Biotium	100uL	EUR 199
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF543 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC431792-500	Biotium	500uL	EUR 544
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF543 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC041791-100	Biotium	100uL	EUR 199
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF405S conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC041791-500	Biotium	500uL	EUR 544
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF405S conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC041792-100	Biotium	100uL	EUR 199
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF405S conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC041792-500	Biotium	500uL	EUR 544
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF405S conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC701791-100	Biotium	100uL	EUR 199
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF770 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC701791-500	Biotium	500uL	EUR 544
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF770 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC701792-100	Biotium	100uL	EUR 199
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF770 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC701792-500	Biotium	500uL	EUR 544
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF770 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC801791-100	Biotium	100uL	EUR 199
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF680 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC801791-500	Biotium	500uL	EUR 544
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF680 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC801792-100	Biotium	100uL	EUR 199
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF680 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC801792-500	Biotium	500uL	EUR 544
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF680 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNCH1791-100	Biotium	100uL	EUR 199
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNCH1791-500	Biotium	500uL	EUR 544
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNCH1792-100	Biotium	100uL	EUR 199
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNCH1792-500	Biotium	500uL	EUR 544
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNCP1791-250	Biotium	250uL	EUR 383
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),PerCP conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNCP1792-250	Biotium	250uL	EUR 383
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),PerCP conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNCR1791-250	Biotium	250uL	EUR 383
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),RPE conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNCR1792-250	Biotium	250uL	EUR 383
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),RPE conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC941791-100	Biotium	100uL	EUR 199
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF594 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC941791-500	Biotium	500uL	EUR 544
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF594 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC941792-100	Biotium	100uL	EUR 199
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF594 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC941792-500	Biotium	500uL	EUR 544
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF594 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNCA1791-250	Biotium	250uL	EUR 383
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),APC conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNCA1792-250	Biotium	250uL	EUR 383
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),APC conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNCB1791-100	Biotium	100uL	EUR 199
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),Biotin conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNCB1791-500	Biotium	500uL	EUR 544
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),Biotin conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNCB1792-100	Biotium	100uL	EUR 199
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),Biotin conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNCB1792-500	Biotium	500uL	EUR 544
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),Biotin conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC881791-100	Biotium	100uL	EUR 199
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF488A conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC881791-500	Biotium	500uL	EUR 544
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF488A conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC881792-100	Biotium	100uL	EUR 199
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF488A conjugate, Concentration: 0.1mg/mL