influenza-x

Epitranscriptomic regulation by m 6 A RNA methylation in mind growth and ailments

 

  • Mobile RNAs are pervasively tagged with numerous chemical moieties, collectively known as epitranscriptomic modifications. The methylation of adenosine at N6place generates N6-methyladenosine (m6A), which is essentially the most ample and reversible epitranscriptomic modification in mammals.
  • The m6A signaling is mediated by a devoted set of proteins comprised of writers, erasers, and readers. Opposite to the activation-repression binary view of gene regulation, rising proof means that the m6A methylation controls a number of elements of mRNA metabolism, akin to splicing, export, stability, translation, and degradation, culminating within the fine-tuning of gene expression.
  • Mind exhibits the best abundance of m6A methylation within the physique, which is developmentally altered. Inside the mind, m6A methylation is biased towards neuronal transcripts and delicate to neuronal exercise. In a wholesome mind, m6A maintains a number of developmental and physiological processes akin to neurogenesis, axonal development, synaptic plasticity, circadian rhythm, cognitive perform, and stress response. The m6A imbalance contributes to the pathogenesis of acute and continual CNS insults, mind most cancers, and neuropsychiatric problems.

 

  • This overview mentioned the molecular mechanisms of m6A regulation and its implication within the developmental, physiological, and pathological processes of the mind.

 

influenza-x

influenza-x

GNAS Complex Locus (GNAS) Antibody

20-abx214658
  • EUR 411.00
  • EUR 300.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Gnas Complex Locus (GNAS) Antibody

20-abx112824
  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.

GNAS Complex Locus (GNAS) Antibody

20-abx338380
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

GNAS antibody

70R-1643 100 ug
EUR 377.00
Description: Rabbit polyclonal GNAS antibody raised against the N terminal of GNAS

GNAS antibody

70R-1651 100 ug
EUR 377.00
Description: Rabbit polyclonal GNAS antibody raised against the C terminal of GNAS

GNAS antibody

70R-1652 100 ug
EUR 377.00
Description: Rabbit polyclonal GNAS antibody raised against the N terminal of GNAS

GNAS antibody

70R-12940 100 ul
EUR 457.00
Description: Affinity purified Rabbit polyclonal GNAS antibody

GNAS antibody

70R-13520 100 ul
EUR 457.00
Description: Affinity purified Rabbit polyclonal GNAS antibody

GNAS antibody

70R-21619 50 ul
EUR 435.00
Description: Rabbit polyclonal GNAS antibody

GNAS Antibody

32899-100ul 100ul
EUR 252.00

GNAS antibody

38452-100ul 100ul
EUR 252.00

GNAS Antibody

1-CSB-PA147947
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

GNAS Antibody

DF7068 200ul
EUR 304.00
Description: GNAS Antibody detects endogenous levels of total GNAS.

GNAS Antibody

DF7388 200ul
EUR 304.00
Description: GNAS Antibody detects endogenous levels of total GNAS.

GNAS Antibody

1-CSB-PA307619LA01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:500-1:1000, IF:1:200-1:500

GNAS Antibody

1-CSB-PA352389LA01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

GNAS Antibody

1-CSB-PA247539
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:200-1:1000, IHC:1:25-1:100

GNAS antibody

70R-5756 50 ug
EUR 467.00
Description: Rabbit polyclonal GNAS antibody raised against the N terminal of GNAS

GNAS Antibody

1-CSB-PA009596GA01HU
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

GNAS Antibody

ABD7068 100 ug
EUR 438.00

GNAS Antibody

ABD7388 100 ug
EUR 438.00

GNAS Complex Locus (GNAS) Antibody (HRP)

20-abx337231
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

GNAS Complex Locus (GNAS) Antibody (FITC)

20-abx337232
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

GNAS Complex Locus (GNAS) Antibody (Biotin)

20-abx337233
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

GNAS complex locus (GNAS) polyclonal antibody

ABP-PAB-11314 100 ug Ask for price
    • Product line: Miscellaneous
    • Brand:

GNAS Conjugated Antibody

C32899 100ul
EUR 397.00

NESP55,GNAS Antibody

abx235663-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

GNAS Antibody (HRP)

20-abx306647
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

GNAS Antibody (FITC)

20-abx306648
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

GNAS Antibody (Biotin)

20-abx306649
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

GNAS Polyclonal Antibody

A68803 100 ?g
EUR 628.55
Description: Ask the seller for details

GNAS Polyclonal Antibody

A64422 100 µg
EUR 570.55
Description: The best epigenetics products

anti- GNAS antibody

FNab03536 100µg
EUR 505.25
  • Immunogen: GNAS complex locus
  • Uniprot ID: O95467
  • Gene ID: 2778
  • Research Area: Neuroscience, Cancer, Immunology, Signal Transduction
Description: Antibody raised against GNAS

Anti-GNAS antibody

PAab03536 100 ug
EUR 355.00

Anti-GNAS antibody

STJ27492 100 µl
EUR 277.00
Description: This locus has a highly complex imprinted expression pattern. It gives rise to maternally, paternally, and biallelically expressed transcripts that are derived from four alternative promoters and 5' exons. Some transcripts contain a differentially methylated region (DMR) at their 5' exons, and this DMR is commonly found in imprinted genes and correlates with transcript expression. An antisense transcript is produced from an overlapping locus on the opposite strand. One of the transcripts produced from this locus, and the antisense transcript, are paternally expressed noncoding RNAs, and may regulate imprinting in this region. In addition, one of the transcripts contains a second overlapping ORF, which encodes a structurally unrelated protein - Alex. Alternative splicing of downstream exons is also observed, which results in different forms of the stimulatory G-protein alpha subunit, a key element of the classical signal transduction pathway linking receptor-ligand interactions with the activation of adenylyl cyclase and a variety of cellular reponses. Multiple transcript variants encoding different isoforms have been found for this gene. Mutations in this gene result in pseudohypoparathyroidism type 1a, pseudohypoparathyroidism type 1b, Albright hereditary osteodystrophy, pseudopseudohypoparathyroidism, McCune-Albright syndrome, progressive osseus heteroplasia, polyostotic fibrous dysplasia of bone, and some pituitary tumors.

Anti-GNAS antibody

STJ23816 100 µl
EUR 277.00
Description: This locus has a highly complex imprinted expression pattern. It gives rise to maternally, paternally, and biallelically expressed transcripts that are derived from four alternative promoters and 5' exons. Some transcripts contain a differentially methylated region (DMR) at their 5' exons, and this DMR is commonly found in imprinted genes and correlates with transcript expression. An antisense transcript is produced from an overlapping locus on the opposite strand. One of the transcripts produced from this locus, and the antisense transcript, are paternally expressed noncoding RNAs, and may regulate imprinting in this region. In addition, one of the transcripts contains a second overlapping ORF, which encodes a structurally unrelated protein - Alex. Alternative splicing of downstream exons is also observed, which results in different forms of the stimulatory G-protein alpha subunit, a key element of the classical signal transduction pathway linking receptor-ligand interactions with the activation of adenylyl cyclase and a variety of cellular reponses. Multiple transcript variants encoding different isoforms have been found for this gene. Mutations in this gene result in pseudohypoparathyroidism type 1a, pseudohypoparathyroidism type 1b, Albright hereditary osteodystrophy, pseudopseudohypoparathyroidism, McCune-Albright syndrome, progressive osseus heteroplasia, polyostotic fibrous dysplasia of bone, and some pituitary tumors.

Anti-GNAS antibody

STJ72252 100 µg
EUR 359.00

Gnas/ Rat Gnas ELISA Kit

ELI-12714r 96 Tests
EUR 886.00

Gnas/ Rat Gnas ELISA Kit

ELI-27931r 96 Tests
EUR 886.00

Gnas/ Rat Gnas ELISA Kit

ELI-35065r 96 Tests
EUR 886.00

Gnas/ Rat Gnas ELISA Kit

ELI-47242r 96 Tests
EUR 886.00

GNAS siRNA

20-abx900009
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

GNAS siRNA

20-abx900030
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

GNAS siRNA

20-abx918154
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

GNAS siRNA

20-abx918155
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

GNAS siRNA

20-abx918156
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

GNAS siRNA

20-abx918157
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

GNAS siRNA

20-abx918158
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

GNAS siRNA

20-abx918159
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

GNAS siRNA

20-abx918160
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

GNAS siRNA

20-abx918161
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

pBluescriptR-GNAS

PVT17793 2 ug
EUR 231.00

Polyclonal GNAS Antibody (Center)

APR05815G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNAS (Center). This antibody is tested and proven to work in the following applications:

GNAS Antibody, Biotin conjugated

1-CSB-PA352389LD01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GNAS Antibody, HRP conjugated

1-CSB-PA307619LB01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GNAS Antibody, FITC conjugated

1-CSB-PA307619LC01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GNAS Antibody, Biotin conjugated

1-CSB-PA307619LD01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GNAS Antibody, HRP conjugated

1-CSB-PA352389LB01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GNAS Antibody, FITC conjugated

1-CSB-PA352389LC01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

anti- NESP55,GNAS antibody

FNab05663 100µg
EUR 505.25
  • Recommended dilution: WB: 1:1000-1:4000
  • IHC: 1:50-1:500
  • Immunogen: GNAS complex locus
  • Uniprot ID: O95467
  • Research Area: cancer, Metabolism
Description: Antibody raised against NESP55,GNAS

Polyclonal GNAS Antibody (C-term)

APR04328G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNAS (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal GNAS Antibody (internal region)

APG00677G 0.1mg
EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human GNAS (internal region). This antibody is tested and proven to work in the following applications:

Polyclonal GNAS Antibody (aa385-394)

APR02185G 0.05mg
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNAS (aa385-394). This antibody is tested and proven to work in the following applications:

Monoclonal GNAS Antibody, Clone: 7G6G5

AMM03034G 0.1ml
EUR 528.00
Description: A Monoclonal antibody against Human GNAS. The antibodies are raised in Mouse and are from clone 7G6G5. This antibody is applicable in WB and IHC, FC, ICC, E

Monoclonal GNAS Antibody, Clone: 2A2B7

AMM03035G 0.1ml
EUR 528.00
Description: A Monoclonal antibody against Human GNAS. The antibodies are raised in Mouse and are from clone 2A2B7. This antibody is applicable in WB and IHC, FC, ICC, E

Polyclonal GNAS Antibody (N-Term)

AMM04827G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNAS (N-Term). This antibody is tested and proven to work in the following applications:

GNAS Polyclonal Antibody, HRP Conjugated

A68804 100 ?g
EUR 628.55
Description: The best epigenetics products

GNAS Polyclonal Antibody, FITC Conjugated

A68805 100 ?g
EUR 628.55
Description: kits suitable for this type of research

GNAS Polyclonal Antibody, Biotin Conjugated

A68806 100 ?g
EUR 628.55
Description: fast delivery possible

GNAS Polyclonal Antibody, HRP Conjugated

A64423 100 µg
EUR 570.55
Description: kits suitable for this type of research

GNAS Polyclonal Antibody, FITC Conjugated

A64424 100 µg
EUR 570.55
Description: fast delivery possible

GNAS Polyclonal Antibody, Biotin Conjugated

A64425 100 µg
EUR 570.55
Description: reagents widely cited

GNAS Blocking Peptide

33R-10097 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAS antibody, catalog no. 70R-1651

GNAS Blocking Peptide

33R-8471 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAS antibody, catalog no. 70R-1652

GNAS Blocking Peptide

33R-9925 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAS antibody, catalog no. 70R-5756

GNAS Blocking Peptide

33R-6814 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAS antibody, catalog no. 70R-1643

GNAS Blocking Peptide

DF7068-BP 1mg
EUR 195.00

GNAS Blocking Peptide

DF7388-BP 1mg
EUR 195.00

GNAS cloning plasmid

CSB-CL009596HU1-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1185
  • Sequence: atgggctgcctcgggaacagtaagaccgaggaccagcgcaacgaggagaaggcgcagcgtgaggccaacaaaaagatcgagaagcagctgcagaaggacaagcaggtctaccgggccacgcaccgcctgctgctgctgggtgctggagaatctggtaaaagcaccattgtgaagc
  • Show more
Description: A cloning plasmid for the GNAS gene.

GNAS cloning plasmid

CSB-CL009596HU2-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1188
  • Sequence: atgggctgcctcgggaacagtaagaccgaggaccagcgcaacgaggagaaggcgcagcgtgaggccaacaaaaagatcgagaagcagctgcagaaggacaagcaggtctaccgggccacgcaccgcctgctgctgctgggtgctggagaatctggtaaaagcaccattgtgaagc
  • Show more
Description: A cloning plasmid for the GNAS gene.

GNAS Rabbit pAb

A5546-100ul 100 ul
EUR 308.00

GNAS Rabbit pAb

A5546-200ul 200 ul
EUR 459.00

GNAS Rabbit pAb

A5546-20ul 20 ul
EUR 183.00

GNAS Rabbit pAb

A5546-50ul 50 ul
EUR 223.00

GNAS Rabbit pAb

A2732-100ul 100 ul
EUR 308.00

GNAS Rabbit pAb

A2732-200ul 200 ul
EUR 459.00

GNAS Rabbit pAb

A2732-20ul 20 ul
EUR 183.00

GNAS Rabbit pAb

A2732-50ul 50 ul
EUR 223.00

Recombinant human GNAS

P1012 100ug Ask for price
  • Uniprot ID: O95467
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human GNAS

pSV40- Gnas- m

PVT11671 2 ug
EUR 273.00

Human GNAS ELISA KIT

ELI-12712h 96 Tests
EUR 824.00

Mouse Gnas ELISA KIT

ELI-12713m 96 Tests
EUR 865.00

Canine GNAS ELISA KIT

ELI-27250d 96 Tests
EUR 928.00

GNAS ELISA KIT|Human

EF009911 96 Tests
EUR 689.00

Rat GNAS shRNA Plasmid

20-abx984695
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Rat GNAS shRNA Plasmid

20-abx984696
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Human GNAS shRNA Plasmid

20-abx951847
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Human GNAS shRNA Plasmid

20-abx951848
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Human GNAS shRNA Plasmid

20-abx951849
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Human GNAS shRNA Plasmid

20-abx951850
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Mouse GNAS shRNA Plasmid

20-abx970580
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Mouse GNAS shRNA Plasmid

20-abx970581
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Mouse GNAS shRNA Plasmid

20-abx970582
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Mouse GNAS shRNA Plasmid

20-abx970583
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Bovine GNAS ELISA KIT

ELI-38027b 96 Tests
EUR 928.00

Mouse Gnas ELISA KIT

ELI-48020m 96 Tests
EUR 865.00

Human GNAS ELISA KIT

ELI-48772h 96 Tests
EUR 824.00

NESP55/GNAS ELISA KIT|Human

EF001179 96 Tests
EUR 689.00

Gnas ORF Vector (Rat) (pORF)

ORF067655 1.0 ug DNA
EUR 506.00

Gnas ORF Vector (Rat) (pORF)

ORF067656 1.0 ug DNA
EUR 506.00

Gnas ORF Vector (Rat) (pORF)

ORF067657 1.0 ug DNA
EUR 506.00

Gnas ORF Vector (Rat) (pORF)

ORF067658 1.0 ug DNA
EUR 506.00

Gnas ORF Vector (Rat) (pORF)

ORF067659 1.0 ug DNA
EUR 506.00

GNAS ORF Vector (Human) (pORF)

ORF004496 1.0 ug DNA
EUR 95.00

GNAS ORF Vector (Human) (pORF)

ORF004497 1.0 ug DNA
EUR 95.00

Gnas ORF Vector (Mouse) (pORF)

ORF046308 1.0 ug DNA
EUR 506.00

Gnas ORF Vector (Mouse) (pORF)

ORF046309 1.0 ug DNA
EUR 506.00

Gnas ORF Vector (Mouse) (pORF)

ORF046310 1.0 ug DNA
EUR 506.00

Gnas ORF Vector (Mouse) (pORF)

ORF046311 1.0 ug DNA
EUR 506.00

Gnas ORF Vector (Mouse) (pORF)

ORF046312 1.0 ug DNA
EUR 506.00

Gnas ORF Vector (Mouse) (pORF)

ORF046313 1.0 ug DNA
EUR 506.00

Gnas ORF Vector (Mouse) (pORF)

ORF046314 1.0 ug DNA
EUR 506.00

Gnas ORF Vector (Mouse) (pORF)

ORF046315 1.0 ug DNA
EUR 506.00

Mouse Protein ALEX, Gnas ELISA KIT

ELI-24352m 96 Tests
EUR 865.00

Human Protein ALEX, GNAS ELISA KIT

ELI-24547h 96 Tests
EUR 824.00

Gnas sgRNA CRISPR Lentivector set (Rat)

K7535001 3 x 1.0 ug
EUR 339.00

Gnas sgRNA CRISPR Lentivector set (Mouse)

K4363501 3 x 1.0 ug
EUR 339.00

GNAS sgRNA CRISPR Lentivector set (Human)

K0875301 3 x 1.0 ug
EUR 339.00

GNAS-AS1 ORF Vector (Human) (pORF)

ORF020250 1.0 ug DNA
EUR 95.00

pECMV-3脳FLAG-GNAS vector

PVT12057 2 ug
EUR 352.00

Mouse Neuroendocrine Secretory Protein (GNAS) ELISA Kit

abx392277-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

Rat Neuroendocrine Secretory Protein (GNAS) ELISA Kit

abx392284-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

Human Neuroendocrine Secretory Protein (GNAS) ELISA Kit

abx387603-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

Gnas sgRNA CRISPR Lentivector (Rat) (Target 1)

K7535002 1.0 ug DNA
EUR 154.00

Gnas sgRNA CRISPR Lentivector (Rat) (Target 2)

K7535003 1.0 ug DNA
EUR 154.00

Gnas sgRNA CRISPR Lentivector (Rat) (Target 3)

K7535004 1.0 ug DNA
EUR 154.00

Gnas sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4363502 1.0 ug DNA
EUR 154.00

Gnas sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4363503 1.0 ug DNA
EUR 154.00

Gnas sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4363504 1.0 ug DNA
EUR 154.00

GNAS sgRNA CRISPR Lentivector (Human) (Target 1)

K0875302 1.0 ug DNA
EUR 154.00

GNAS sgRNA CRISPR Lentivector (Human) (Target 2)

K0875303 1.0 ug DNA
EUR 154.00

GNAS sgRNA CRISPR Lentivector (Human) (Target 3)

K0875304 1.0 ug DNA
EUR 154.00

GNAS Protein Vector (Rat) (pPB-C-His)

PV270618 500 ng
EUR 603.00

GNAS Protein Vector (Rat) (pPB-N-His)

PV270619 500 ng
EUR 603.00

GNAS Protein Vector (Rat) (pPM-C-HA)

PV270620 500 ng
EUR 603.00

GNAS Protein Vector (Rat) (pPM-C-His)

PV270621 500 ng
EUR 603.00

GNAS Protein Vector (Rat) (pPB-C-His)

PV270622 500 ng
EUR 603.00

GNAS Protein Vector (Rat) (pPB-N-His)

PV270623 500 ng
EUR 603.00

GNAS Protein Vector (Rat) (pPM-C-HA)

PV270624 500 ng
EUR 603.00

GNAS Protein Vector (Rat) (pPM-C-His)

PV270625 500 ng
EUR 603.00

GNAS Protein Vector (Rat) (pPB-C-His)

PV270626 500 ng
EUR 1166.00

GNAS Protein Vector (Rat) (pPB-N-His)

PV270627 500 ng
EUR 1166.00

GNAS Protein Vector (Rat) (pPM-C-HA)

PV270628 500 ng
EUR 1166.00

GNAS Protein Vector (Rat) (pPM-C-His)

PV270629 500 ng
EUR 1166.00

GNAS Protein Vector (Rat) (pPB-C-His)

PV270630 500 ng
EUR 1166.00

GNAS Protein Vector (Rat) (pPB-N-His)

PV270631 500 ng
EUR 1166.00

GNAS Protein Vector (Rat) (pPM-C-HA)

PV270632 500 ng
EUR 1166.00

GNAS Protein Vector (Rat) (pPM-C-His)

PV270633 500 ng
EUR 1166.00

GNAS Protein Vector (Rat) (pPB-C-His)

PV270634 500 ng
EUR 603.00

GNAS Protein Vector (Rat) (pPB-N-His)

PV270635 500 ng
EUR 603.00

GNAS Protein Vector (Rat) (pPM-C-HA)

PV270636 500 ng
EUR 603.00

GNAS Protein Vector (Rat) (pPM-C-His)

PV270637 500 ng
EUR 603.00

GNAS Protein Vector (Mouse) (pPB-C-His)

PV185230 500 ng
EUR 603.00

GNAS Protein Vector (Mouse) (pPB-N-His)

PV185231 500 ng
EUR 603.00

GNAS Protein Vector (Mouse) (pPM-C-HA)

PV185232 500 ng
EUR 603.00

GNAS Protein Vector (Mouse) (pPM-C-His)

PV185233 500 ng
EUR 603.00

GNAS Protein Vector (Mouse) (pPB-C-His)

PV185234 500 ng
EUR 603.00

GNAS Protein Vector (Mouse) (pPB-N-His)

PV185235 500 ng
EUR 603.00

GNAS Protein Vector (Mouse) (pPM-C-HA)

PV185236 500 ng
EUR 603.00

GNAS Protein Vector (Mouse) (pPM-C-His)

PV185237 500 ng
EUR 603.00

GNAS Protein Vector (Mouse) (pPB-C-His)

PV185238 500 ng
EUR 1065.00

GNAS Protein Vector (Mouse) (pPB-N-His)

PV185239 500 ng
EUR 1065.00

GNAS Protein Vector (Mouse) (pPM-C-HA)

PV185240 500 ng
EUR 1065.00

GNAS Protein Vector (Mouse) (pPM-C-His)

PV185241 500 ng
EUR 1065.00

GNAS Protein Vector (Mouse) (pPB-C-His)

PV185242 500 ng
EUR 1065.00

GNAS Protein Vector (Mouse) (pPB-N-His)

PV185243 500 ng
EUR 1065.00

GNAS Protein Vector (Mouse) (pPM-C-HA)

PV185244 500 ng
EUR 1065.00

GNAS Protein Vector (Mouse) (pPM-C-His)

PV185245 500 ng
EUR 1065.00

GNAS Protein Vector (Mouse) (pPB-C-His)

PV185246 500 ng
EUR 1065.00

GNAS Protein Vector (Mouse) (pPB-N-His)

PV185247 500 ng
EUR 1065.00

GNAS Protein Vector (Mouse) (pPM-C-HA)

PV185248 500 ng
EUR 1065.00

GNAS Protein Vector (Mouse) (pPM-C-His)

PV185249 500 ng
EUR 1065.00

GNAS Protein Vector (Mouse) (pPB-C-His)

PV185250 500 ng
EUR 1065.00

GNAS Protein Vector (Mouse) (pPB-N-His)

PV185251 500 ng
EUR 1065.00

GNAS Protein Vector (Mouse) (pPM-C-HA)

PV185252 500 ng
EUR 1065.00

GNAS Protein Vector (Mouse) (pPM-C-His)

PV185253 500 ng
EUR 1065.00

RNA-Binding Proteins in Most cancers: Practical and Therapeutic Views

 

RNA-binding proteins (RBPs) crucially regulate gene expression by post-transcriptional regulation, akin to by modulating microRNA (miRNA) processing and the choice splicing, different polyadenylation, subcellular localization, stability, and translation of RNAs. Greater than 1500 RBPs have been recognized so far, and plenty of of them are recognized to be deregulated in most cancers. Alterations within the expression and localization of RBPs can affect the expression ranges of oncogenes, tumor-suppressor genes, and genome stability-related genes.

RBP-mediated gene regulation can result in numerous cancer-related mobile phenotypes, akin to proliferation, apoptosis, angiogenesis, senescence, and epithelial-mesenchymal transition (EMT)/invasion/metastasis. This regulation can be related to most cancers prognosis.

Thus, RBPs could be potential targets for the event of therapeutics for the most cancers therapy. On this overview, we describe the molecular features of RBPs, their roles in cancer-related mobile phenotypes, and numerous approaches that could be used to focus on RBPs for most cancers therapy.

 

Circulating Lengthy Non-Coding RNA GAS5 Is Overexpressed in Serum from Osteoporotic Sufferers and Is Related to Elevated Danger of Bone Fragility

 

Osteoporosis (OP) is a multifactorial dysfunction through which environmental elements together with genetic variants and epigenetic mechanisms have been implicated. Lengthy non-coding RNAs (lncRNAs) have just lately emerged as essential regulators of bone metabolism and OP aetiology.

On this research, we analyzed the expression degree and the genetic affiliation of lncRNA GAS5 in OP sufferers in comparison with controls. Quantitative RT-PCR evaluation of GAS5 was carried out on the serum of 56 OP sufferers and 28 wholesome people. OP topics had been divided into three teams of research: 29 with fragility fractures of lumbar backbone (OP_VF), 14 with fragility fractures of femoral neck (OP_FF) and 13 with out fractures (OP_WF). Genotyping of the rs145204276 insertion/deletion polymorphism has additionally been carried out by Restriction fragment size polymorphism (RFLP) and direct sequencing analyses.

Expression of circulating GAS5 is considerably elevated in OP sufferers in comparison with controls (p < 0.01), with a statistically greater significance in fractured OP people vs. wholesome topics (p < 0.001). No statistically important change was present in feminine OP sufferers; conversely, GAS5 is upregulated within the subgroup of fractured OP ladies sera (p < 0.01) and in all OP males (p < 0.05). Moreover, a direct correlation between GAS5 expression degree and parathyroid hormone (PTH) focus was present in OP sufferers (r = 0.2930; p = 0.0389).

Genetic evaluation of rs145204276 revealed that the deletion allele was correlated with the next expression of GAS5 in OP sufferers (0.22 ± 0.02 vs. 0.15 ± 0.01, ** p < 0.01). Our outcomes recommend circulating GAS5 as a putative biomarker for the prognosis and prognosis of OP and OP-related fractures.

 

Rat Sex Determining Region Y Box Protein 2 (SOX2) ELISA Kit

RD-SOX2-Ra-96Tests 96 Tests
EUR 709.00

Rat Sex Determining Region Y Box Protein 2 (SOX2) ELISA Kit

RDR-SOX2-Ra-48Tests 48 Tests
EUR 534.00

Rat Sex Determining Region Y Box Protein 2 (SOX2) ELISA Kit

RDR-SOX2-Ra-96Tests 96 Tests
EUR 742.00

SOX2 Antibody

25044-100ul 100ul
EUR 390.00

Sox2 antibody

20R-1751 100 ug
EUR 673.00
Description: Rabbit polyclonal Sox2 antibody

SOX2 antibody

20R-2500 50 ug
EUR 281.00
Description: Rabbit polyclonal SOX2 antibody

SOX2 Antibody

21425-100ul 100ul
EUR 252.00

SOX2 Antibody

21425-50ul 50ul
EUR 187.00

SOX2 Antibody

31128-100ul 100ul
EUR 252.00

SOX2 Antibody

31128-50ul 50ul
EUR 187.00

SOX2 antibody

70R-12166 100 ug
EUR 403.00
Description: Rabbit polyclonal SOX2 antibody

SOX2 antibody

70R-20460 50 ul
EUR 435.00
Description: Rabbit polyclonal SOX2 antibody

SOX2 Antibody

48128-100ul 100ul
EUR 333.00

SOX2 Antibody

48128-50ul 50ul
EUR 239.00

SOX2 antibody

38134-100ul 100ul
EUR 252.00

SOX2 antibody

10R-11127 100 ug
EUR 349.00
Description: Mouse monoclonal SOX2 antibody

SOX2 Antibody

43142-100ul 100ul
EUR 252.00

SOX2 Antibody

CSB-PA982860-
EUR 335.00
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against SOX2. Recognizes SOX2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

SOX2 Antibody

CSB-PA982860-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against SOX2. Recognizes SOX2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

SOX2 Antibody

1-CSB-PA698932
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SOX2. Recognizes SOX2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

SOX2 Antibody

DF6109 200ul
EUR 304.00
Description: SOX2 Antibody detects endogenous levels of total SOX2.

SOX2 Antibody

1-CSB-PA588368
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SOX2. Recognizes SOX2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:15-1:50

SOX2 Antibody

1-CSB-PA16539A0Rb
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SOX2. Recognizes SOX2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

Sox2 antibody

70R-SR013 100 ug
EUR 300.00
Description: Affinity purified Rabbit polyclonal Sox2 antibody

SOX2 antibody

70R-33158 100 ug
EUR 435.00
Description: Rabbit polyclonal SOX2 antibody

SOX2 antibody

70R-33160 100 ug
EUR 435.00
Description: Rabbit polyclonal SOX2 antibody

SOX2 Antibody

AF4010 200ul
EUR 376.00
Description: The antibody detects endogenous level of total SOX2 protein.

SOX2 Antibody

AF5140 200ul
EUR 304.00
Description: SOX2 Antibody detects endogenous levels of total SOX2.

SOX2 Antibody

BF0481 200ul
EUR 376.00
Description: SOX2 antibody detects endogenous levels of total SOX2.

SOX2 Antibody

1-CSB-PA022426GA01HU
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SOX2. Recognizes SOX2 from Human, Mouse, Rat, Zebrafish. This antibody is Unconjugated. Tested in the following application: ELISA, IF

sox2 Antibody

AF7950 200ul
EUR 376.00
Description: sox2 Antibody detects endogenous levels of sox2.

SOX2 Antibody

ABD6109 100 ug
EUR 438.00

SOX2 Antibody

ABF4010 100 ug
EUR 438.00

SOX2 Antibody

ABF5140 100 ug
EUR 438.00

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNUM1791-50 50uL
EUR 395.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791), 1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNUM1792-50 50uL
EUR 395.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792), 1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNUB1791-100 100uL
EUR 209.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791), Concentration: 0.2mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNUB1791-500 500uL
EUR 458.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791), Concentration: 0.2mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNUB1792-100 100uL
EUR 209.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792), Concentration: 0.2mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNUB1792-500 500uL
EUR 458.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792), Concentration: 0.2mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNC551791-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF555 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNC551791-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF555 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNC551792-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF555 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNC551792-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF555 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNC611791-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF660R conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNC611791-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF660R conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNC611792-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF660R conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNC611792-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF660R conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNC471791-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF647 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNC471791-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF647 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNC471792-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF647 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNC471792-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF647 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNC051791-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF405M conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNC051791-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF405M conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNC051792-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF405M conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNC051792-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF405M conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNC401791-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF640R conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNC401791-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF640R conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNC401792-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF640R conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNC401792-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF640R conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNC431791-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF543 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNC431791-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF543 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNC431792-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF543 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNC431792-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF543 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNC041791-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF405S conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNC041791-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF405S conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNC041792-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF405S conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNC041792-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF405S conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNC701791-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF770 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNC701791-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF770 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNC701792-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF770 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNC701792-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF770 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNC801791-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF680 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNC801791-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF680 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNC801792-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF680 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNC801792-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF680 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNCH1791-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNCH1791-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNCH1792-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNCH1792-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNCP1791-250 250uL
EUR 383.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),PerCP conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNCP1792-250 250uL
EUR 383.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),PerCP conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNCR1791-250 250uL
EUR 383.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),RPE conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNCR1792-250 250uL
EUR 383.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),RPE conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNC941791-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF594 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNC941791-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF594 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNC941792-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF594 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNC941792-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF594 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNCA1791-250 250uL
EUR 383.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),APC conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNCA1792-250 250uL
EUR 383.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),APC conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNCB1791-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),Biotin conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNCB1791-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),Biotin conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNCB1792-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),Biotin conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNCB1792-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),Biotin conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNC881791-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF488A conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNC881791-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF488A conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNC881792-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF488A conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNC881792-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF488A conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNC681791-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF568 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNC681791-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF568 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNC681792-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF568 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNC681792-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF568 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNCAP1791-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNCAP1791-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNCAP1792-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNCAP1792-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNC811791-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF680R conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody

BNC811791-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF680R conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNC811792-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF680R conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody

BNC811792-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF680R conjugate, Concentration: 0.1mg/mL

SOX2

GT15098 100 ug.
EUR 539.00

SOX2

P25021 50 ul. Blocking Peptide
EUR 174.00

SOX2

MO15040 100 ug
EUR 435.00

SOX2

RA25021 100 ul
EUR 409.00

SOX2 Monoclonal Antibody

27015-100ul 100ul
EUR 252.00

SOX2 Monoclonal Antibody

27015-50ul 50ul
EUR 187.00

Human SOX2 Antibody

32612-05111 150 ug
EUR 261.00

SOX2 (pS83) Antibody

abx032060-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

SOX2 (pS83) Antibody

abx032060-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Sox2 (pS249) Antibody

abx032092-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Sox2 (pS249) Antibody

abx032092-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Sox2 (pS251) Antibody

abx032097-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Sox2 (pS251) Antibody

abx032097-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Sox2 (pS246) Antibody

abx032105-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Sox2 (pS246) Antibody

abx032105-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Polyclonal SOX2 Antibody

APR13481G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SOX2 . This antibody is tested and proven to work in the following applications:

Polyclonal SOX2 Antibody

APR13484G 0.1 mg
EUR 659.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SOX2 . This antibody is tested and proven to work in the following applications:

Monoclonal Sox2 Antibody

APR13485G 0.1ml
EUR 484.00
Description: A Monoclonal antibody against Human Sox2. The antibodies are raised in Mouse. This antibody is applicable in WB, ICC, FC

SOX2 Conjugated Antibody

C43142 100ul
EUR 397.00

SOX2 Conjugated Antibody

C21425 100ul
EUR 397.00

SOX2 Conjugated Antibody

C31128 100ul
EUR 397.00

SOX2 Polyclonal Antibody

A54440 100 µg
EUR 570.55
Description: The best epigenetics products

anti- SOX2 antibody

FNab08125 100µg
EUR 505.25
  • Recommended dilution: WB: 1:2000-1:20000
  • IHC: 1:50-1:200
  • IF: 1:50-1:500
  • Immunogen: SRY(sex determining region Y)-box 2
  • Uniprot ID: P48431
  • Gene ID: 6657
  • Research Area: Neuroscience, Stem Cells, Metabolism, Epigenetics
Description: Antibody raised against SOX2

anti- SOX2 antibody

FNab08126 100µg
EUR 505.25
  • Immunogen: SRY(sex determining region Y)-box 2
  • Uniprot ID: P48431
  • Gene ID: 6657
  • Research Area: Neuroscience, Stem Cells, Metabolism, Epigenetics
Description: Antibody raised against SOX2

anti- SOX2 antibody

FNab10148 100µg
EUR 585.00
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:50-1:200
  • Immunogen: SRY(sex determining region Y)-box 2
  • Uniprot ID: P48431
  • Gene ID: 6657
  • Research Area: Neuroscience, Stem Cells, Metabolism, Epigenetics
Description: Antibody raised against SOX2

Anti-SOX2 Antibody

PA2284 100ug/vial
EUR 334.00

Anti-SOX2 antibody

PAab08125 100 ug
EUR 355.00

Anti-SOX2 antibody

PAab08126 100 ug
EUR 355.00

Anti-SOX2 antibody

STJ25661 100 µl
EUR 277.00
Description: This intronless gene encodes a member of the SRY-related HMG-box (SOX) family of transcription factors involved in the regulation of embryonic development and in the determination of cell fate. The product of this gene is required for stem-cell maintenance in the central nervous system, and also regulates gene expression in the stomach. Mutations in this gene have been associated with optic nerve hypoplasia and with syndromic microphthalmia, a severe form of structural eye malformation. This gene lies within an intron of another gene called SOX2 overlapping transcript (SOX2OT).

Anti-SOX2 antibody

STJ113816 100 µl
EUR 277.00
Description: This intronless gene encodes a member of the SRY-related HMG-box (SOX) family of transcription factors involved in the regulation of embryonic development and in the determination of cell fate. The product of this gene is required for stem-cell maintenance in the central nervous system, and also regulates gene expression in the stomach. Mutations in this gene have been associated with optic nerve hypoplasia and with syndromic microphthalmia, a severe form of structural eye malformation. This gene lies within an intron of another gene called SOX2 overlapping transcript (SOX2OT).

Anti-SOX2 antibody

STJ160068 7 mL P
EUR 402.00
Description: SOX 2, also known as SRY (sex determining region Y)-box 2, is a transcription factor that acts to regulate pluripotency of undifferentiated embryonic stem cells, and to regulate gene expression in the stomach. This diagnostic grade SOX 2 IVD antibody is used to detect melanoma, testicular germ cell tumor, cervical carcinoma, lung cancer, breast cancer with basal cell phenotype, and teratoma of the central nervous system. SOX 2 has been reported as a predictor of poor outcome in stage I lung adenocarcinomas. Anti-SOX 2 is also used to recognize squamous cell carcinomas of the lung and gastrointestinal tract, and may be useful for detecting embryonal carcinoma.

Anti-SOX2 antibody

STJ73592 100 µg
EUR 359.00

Anti-SOX2 antibody

STJ73611 100 µg
EUR 359.00

Anti-SOX2 Antibody

STJ503092 100 µg
EUR 476.00

Anti-SOX2 Antibody

STJ503093 100 µg
EUR 476.00

Anti-Sox2 antibody

STJ99043 200 µl
EUR 197.00
Description: Mouse monoclonal to Sox2.

Anti-SOX2 Antibody Clone SOX2/1791, Unconjugated-20ug

6657-MSM1-P0 20ug
EUR 233.00

Anti-SOX2 Antibody Clone SOX2/1791, Unconjugated-100ug

6657-MSM1-P1 100ug
EUR 428.00

Anti-SOX2 Antibody Clone SOX2/1792, Unconjugated-20ug

6657-MSM2-P0 20ug
EUR 233.00

Anti-SOX2 Antibody Clone SOX2/1792, Unconjugated-100ug

6657-MSM2-P1 100ug
EUR 428.00

Sox2 protein

30R-AS055 25 ug
EUR 273.00
Description: Purified recombinant Human Sox2 protein

SOX2 siRNA

20-abx934728
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

SOX2 siRNA

20-abx934729
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

pMXs- Sox2

PVT10444 2 ug
EUR 301.00

SOX2 Plasmid

PVT7186 2 ug
EUR 266.00

anti-SOX2

YF-PA14740 100 ug
EUR 403.00
Description: Rabbit polyclonal to SOX2

anti-SOX2

YF-PA24750 50 ul
EUR 334.00
Description: Mouse polyclonal to SOX2

SOX2 Antibody, HRP conjugated

1-CSB-PA16539B0Rb
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SOX2. Recognizes SOX2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SOX2 Antibody, FITC conjugated

1-CSB-PA16539C0Rb
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SOX2. Recognizes SOX2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SOX2 Antibody, Biotin conjugated

1-CSB-PA16539D0Rb
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SOX2. Recognizes SOX2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Polyclonal SOX2 Antibody (Center)

APR13460G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SOX2 (Center). This antibody is tested and proven to work in the following applications:

Polyclonal SOX2 Antibody (A30)

APR13486G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SOX2 (A30). This antibody is tested and proven to work in the following applications:

Polyclonal SOX2 Antibody (C265)

APR13489G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SOX2 (C265). This antibody is tested and proven to work in the following applications:

Antibody for Human SOX2

SPC-1287D 0.1ml
EUR 314.00
  • The SOX (SRY-box containing gene) gene family encodes a group of transcription factors defined by the conserved high motility group (HMG) DNA-binding domain. They are involved in the regulation of embryonic development when it forms complexes with Oc
  • Show more
Description: A polyclonal antibody for SOX2 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human SOX2. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This SOX2 antibody is unconjugated.

Antibody for Human SOX2

SPC-1287D-A390 0.1ml
EUR 361.00
  • The SOX (SRY-box containing gene) gene family encodes a group of transcription factors defined by the conserved high motility group (HMG) DNA-binding domain. They are involved in the regulation of embryonic development when it forms complexes with Oc
  • Show more
Description: A polyclonal antibody for SOX2 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human SOX2. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This SOX2 antibody is conjugated to ATTO 390.

Antibody for Human SOX2

SPC-1287D-A488 0.1ml
EUR 360.00
  • The SOX (SRY-box containing gene) gene family encodes a group of transcription factors defined by the conserved high motility group (HMG) DNA-binding domain. They are involved in the regulation of embryonic development when it forms complexes with Oc
  • Show more
Description: A polyclonal antibody for SOX2 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human SOX2. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This SOX2 antibody is conjugated to ATTO 488.

Antibody for Human SOX2

SPC-1287D-A565 0.1ml
EUR 360.00
  • The SOX (SRY-box containing gene) gene family encodes a group of transcription factors defined by the conserved high motility group (HMG) DNA-binding domain. They are involved in the regulation of embryonic development when it forms complexes with Oc
  • Show more
Description: A polyclonal antibody for SOX2 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human SOX2. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This SOX2 antibody is conjugated to ATTO 565.

Antibody for Human SOX2

SPC-1287D-A594 0.1ml
EUR 360.00
  • The SOX (SRY-box containing gene) gene family encodes a group of transcription factors defined by the conserved high motility group (HMG) DNA-binding domain. They are involved in the regulation of embryonic development when it forms complexes with Oc
  • Show more
Description: A polyclonal antibody for SOX2 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human SOX2. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This SOX2 antibody is conjugated to ATTO 594.

Antibody for Human SOX2

SPC-1287D-A633 0.1ml
EUR 360.00
  • The SOX (SRY-box containing gene) gene family encodes a group of transcription factors defined by the conserved high motility group (HMG) DNA-binding domain. They are involved in the regulation of embryonic development when it forms complexes with Oc
  • Show more
Description: A polyclonal antibody for SOX2 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human SOX2. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This SOX2 antibody is conjugated to ATTO 633.

Antibody for Human SOX2

SPC-1287D-A655 0.1ml
EUR 360.00
  • The SOX (SRY-box containing gene) gene family encodes a group of transcription factors defined by the conserved high motility group (HMG) DNA-binding domain. They are involved in the regulation of embryonic development when it forms complexes with Oc
  • Show more
Description: A polyclonal antibody for SOX2 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human SOX2. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This SOX2 antibody is conjugated to ATTO 655.

Antibody for Human SOX2

SPC-1287D-A680 0.1ml
EUR 360.00
  • The SOX (SRY-box containing gene) gene family encodes a group of transcription factors defined by the conserved high motility group (HMG) DNA-binding domain. They are involved in the regulation of embryonic development when it forms complexes with Oc
  • Show more
Description: A polyclonal antibody for SOX2 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human SOX2. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This SOX2 antibody is conjugated to ATTO 680.

Antibody for Human SOX2

SPC-1287D-A700 0.1ml
EUR 360.00
  • The SOX (SRY-box containing gene) gene family encodes a group of transcription factors defined by the conserved high motility group (HMG) DNA-binding domain. They are involved in the regulation of embryonic development when it forms complexes with Oc
  • Show more
Description: A polyclonal antibody for SOX2 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human SOX2. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This SOX2 antibody is conjugated to ATTO 700.

Antibody for Human SOX2

SPC-1287D-ALP 0.1ml
EUR 355.00
  • The SOX (SRY-box containing gene) gene family encodes a group of transcription factors defined by the conserved high motility group (HMG) DNA-binding domain. They are involved in the regulation of embryonic development when it forms complexes with Oc
  • Show more
Description: A polyclonal antibody for SOX2 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human SOX2. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This SOX2 antibody is conjugated to Alkaline Phosphatase.

Antibody for Human SOX2

SPC-1287D-APC 0.1ml
EUR 359.00
  • The SOX (SRY-box containing gene) gene family encodes a group of transcription factors defined by the conserved high motility group (HMG) DNA-binding domain. They are involved in the regulation of embryonic development when it forms complexes with Oc
  • Show more
Description: A polyclonal antibody for SOX2 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human SOX2. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This SOX2 antibody is conjugated to APC .

Antibody for Human SOX2

SPC-1287D-APCCY7 0.1ml
EUR 432.00
  • The SOX (SRY-box containing gene) gene family encodes a group of transcription factors defined by the conserved high motility group (HMG) DNA-binding domain. They are involved in the regulation of embryonic development when it forms complexes with Oc
  • Show more
Description: A polyclonal antibody for SOX2 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human SOX2. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This SOX2 antibody is conjugated to APC/Cy7.

Antibody for Human SOX2

SPC-1287D-BI 0.1ml
EUR 357.00
  • The SOX (SRY-box containing gene) gene family encodes a group of transcription factors defined by the conserved high motility group (HMG) DNA-binding domain. They are involved in the regulation of embryonic development when it forms complexes with Oc
  • Show more
Description: A polyclonal antibody for SOX2 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human SOX2. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This SOX2 antibody is conjugated to Biotin.

Antibody for Human SOX2

SPC-1287D-DY350 0.1ml
EUR 436.00
  • The SOX (SRY-box containing gene) gene family encodes a group of transcription factors defined by the conserved high motility group (HMG) DNA-binding domain. They are involved in the regulation of embryonic development when it forms complexes with Oc
  • Show more
Description: A polyclonal antibody for SOX2 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human SOX2. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This SOX2 antibody is conjugated to Dylight 350.

Antibody for Human SOX2

SPC-1287D-DY405 0.1ml
EUR 412.00
  • The SOX (SRY-box containing gene) gene family encodes a group of transcription factors defined by the conserved high motility group (HMG) DNA-binding domain. They are involved in the regulation of embryonic development when it forms complexes with Oc
  • Show more
Description: A polyclonal antibody for SOX2 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human SOX2. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This SOX2 antibody is conjugated to Dylight 405.

Antibody for Human SOX2

SPC-1287D-DY488 0.1ml
EUR 393.00
  • The SOX (SRY-box containing gene) gene family encodes a group of transcription factors defined by the conserved high motility group (HMG) DNA-binding domain. They are involved in the regulation of embryonic development when it forms complexes with Oc
  • Show more
Description: A polyclonal antibody for SOX2 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human SOX2. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This SOX2 antibody is conjugated to Dylight 488.

Antibody for Human SOX2

SPC-1287D-DY594 0.1ml
EUR 397.00
  • The SOX (SRY-box containing gene) gene family encodes a group of transcription factors defined by the conserved high motility group (HMG) DNA-binding domain. They are involved in the regulation of embryonic development when it forms complexes with Oc
  • Show more
Description: A polyclonal antibody for SOX2 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human SOX2. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This SOX2 antibody is conjugated to Dylight 594.

Antibody for Human SOX2

SPC-1287D-DY633 0.1ml
EUR 387.00
  • The SOX (SRY-box containing gene) gene family encodes a group of transcription factors defined by the conserved high motility group (HMG) DNA-binding domain. They are involved in the regulation of embryonic development when it forms complexes with Oc
  • Show more
Description: A polyclonal antibody for SOX2 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human SOX2. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This SOX2 antibody is conjugated to Dylight 633.

Antibody for Human SOX2

SPC-1287D-FITC 0.1ml
EUR 353.00
  • The SOX (SRY-box containing gene) gene family encodes a group of transcription factors defined by the conserved high motility group (HMG) DNA-binding domain. They are involved in the regulation of embryonic development when it forms complexes with Oc
  • Show more
Description: A polyclonal antibody for SOX2 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human SOX2. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This SOX2 antibody is conjugated to FITC.

Antibody for Human SOX2

SPC-1287D-HRP 0.1ml
EUR 349.00
  • The SOX (SRY-box containing gene) gene family encodes a group of transcription factors defined by the conserved high motility group (HMG) DNA-binding domain. They are involved in the regulation of embryonic development when it forms complexes with Oc
  • Show more
Description: A polyclonal antibody for SOX2 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human SOX2. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This SOX2 antibody is conjugated to HRP.

Antibody for Human SOX2

SPC-1287D-P594 0.1ml
EUR 367.00
  • The SOX (SRY-box containing gene) gene family encodes a group of transcription factors defined by the conserved high motility group (HMG) DNA-binding domain. They are involved in the regulation of embryonic development when it forms complexes with Oc
  • Show more
Description: A polyclonal antibody for SOX2 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human SOX2. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This SOX2 antibody is conjugated to PE/ATTO 594.

Antibody for Human SOX2

SPC-1287D-PCP 0.1ml
EUR 359.00
  • The SOX (SRY-box containing gene) gene family encodes a group of transcription factors defined by the conserved high motility group (HMG) DNA-binding domain. They are involved in the regulation of embryonic development when it forms complexes with Oc
  • Show more
Description: A polyclonal antibody for SOX2 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human SOX2. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This SOX2 antibody is conjugated to PerCP.

Antibody for Human SOX2

SPC-1287D-RPE 0.1ml
EUR 358.00
  • The SOX (SRY-box containing gene) gene family encodes a group of transcription factors defined by the conserved high motility group (HMG) DNA-binding domain. They are involved in the regulation of embryonic development when it forms complexes with Oc
  • Show more
Description: A polyclonal antibody for SOX2 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human SOX2. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This SOX2 antibody is conjugated to RPE .

Antibody for Human SOX2

SPC-1287D-STR 0.1ml
EUR 359.00
  • The SOX (SRY-box containing gene) gene family encodes a group of transcription factors defined by the conserved high motility group (HMG) DNA-binding domain. They are involved in the regulation of embryonic development when it forms complexes with Oc
  • Show more
Description: A polyclonal antibody for SOX2 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human SOX2. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This SOX2 antibody is conjugated to Streptavidin.

Anti-SOX2 Antibody BIOTIN

STJ503094 100 µg
EUR 586.00

Anti-SOX2 Antibody FITC

STJ503095 100 µg
EUR 586.00

Anti-SOX2 Antibody BIOTIN

STJ503096 100 µg
EUR 586.00

Anti-SOX2 Antibody FITC

STJ503097 100 µg
EUR 586.00

Human SOX2 Antibody (Biotin Conjugate)

32612-05121 150 ug
EUR 369.00

sox2 (Phospho-Ser249/250) Antibody

13291-100ul 100ul
EUR 252.00