Circulating Lengthy Non-Coding RNA GAS5 Is Overexpressed in Serum from Osteoporotic Sufferers

Epitranscriptomic regulation by m ⁶ A RNA methylation in mind growth and ailments

 

• Mobile RNAs are pervasively tagged with numerous chemical moieties, collectively known as epitranscriptomic modifications. The methylation of adenosine at N⁶place generates N⁶-methyladenosine (m⁶A), which is essentially the most ample and reversible epitranscriptomic modification in mammals.
• The m⁶A signaling is mediated by a devoted set of proteins comprised of writers, erasers, and readers. Opposite to the activation-repression binary view of gene regulation, rising proof means that the m⁶A methylation controls a number of elements of mRNA metabolism, akin to splicing, export, stability, translation, and degradation, culminating within the fine-tuning of gene expression.
• Mind exhibits the best abundance of m⁶A methylation within the physique, which is developmentally altered. Inside the mind, m⁶A methylation is biased towards neuronal transcripts and delicate to neuronal exercise. In a wholesome mind, m⁶A maintains a number of developmental and physiological processes akin to neurogenesis, axonal development, synaptic plasticity, circadian rhythm, cognitive perform, and stress response. The m⁶A imbalance contributes to the pathogenesis of acute and continual CNS insults, mind most cancers, and neuropsychiatric problems.

 

• This overview mentioned the molecular mechanisms of m⁶A regulation and its implication within the developmental, physiological, and pathological processes of the mind.

 

GNAS Complex Locus (GNAS) Antibody
20-abx214658	Abbexa	EUR 411.00 EUR 300.00	0 1
Shipped within 5-10 working days.

Gnas Complex Locus (GNAS) Antibody
20-abx112824	Abbexa	EUR 732.00 EUR 398.00	0 1
Shipped within 5-10 working days.

GNAS Complex Locus (GNAS) Antibody
20-abx338380	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

GNAS antibody
70R-1643	Fitzgerald	100 ug	EUR 377.00
Description: Rabbit polyclonal GNAS antibody raised against the N terminal of GNAS

GNAS antibody
70R-1651	Fitzgerald	100 ug	EUR 377.00
Description: Rabbit polyclonal GNAS antibody raised against the C terminal of GNAS

GNAS antibody
70R-1652	Fitzgerald	100 ug	EUR 377.00
Description: Rabbit polyclonal GNAS antibody raised against the N terminal of GNAS

GNAS antibody
70R-12940	Fitzgerald	100 ul	EUR 457.00
Description: Affinity purified Rabbit polyclonal GNAS antibody

GNAS antibody
70R-13520	Fitzgerald	100 ul	EUR 457.00
Description: Affinity purified Rabbit polyclonal GNAS antibody

GNAS antibody
70R-21619	Fitzgerald	50 ul	EUR 435.00
Description: Rabbit polyclonal GNAS antibody

GNAS Antibody
32899-100ul	SAB	100ul	EUR 252.00

GNAS antibody
38452-100ul	SAB	100ul	EUR 252.00

GNAS Antibody
1-CSB-PA147947	Cusabio	EUR 317.00 EUR 244.00	0 1
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

GNAS Antibody
DF7068	Affbiotech	200ul	EUR 304.00
Description: GNAS Antibody detects endogenous levels of total GNAS.

GNAS Antibody
DF7388	Affbiotech	200ul	EUR 304.00
Description: GNAS Antibody detects endogenous levels of total GNAS.

GNAS Antibody
1-CSB-PA307619LA01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:500-1:1000, IF:1:200-1:500

GNAS Antibody
1-CSB-PA352389LA01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

GNAS Antibody
1-CSB-PA247539	Cusabio	EUR 317.00 EUR 244.00	0 1
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:200-1:1000, IHC:1:25-1:100

GNAS antibody
70R-5756	Fitzgerald	50 ug	EUR 467.00
Description: Rabbit polyclonal GNAS antibody raised against the N terminal of GNAS

GNAS Antibody
1-CSB-PA009596GA01HU	Cusabio	EUR 597.00 EUR 333.00	0 1
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

GNAS Antibody
ABD7068	Lifescience Market	100 ug	EUR 438.00

GNAS Antibody
ABD7388	Lifescience Market	100 ug	EUR 438.00

GNAS Complex Locus (GNAS) Antibody (HRP)
20-abx337231	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

GNAS Complex Locus (GNAS) Antibody (FITC)
20-abx337232	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

GNAS Complex Locus (GNAS) Antibody (Biotin)
20-abx337233	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

GNAS complex locus (GNAS) polyclonal antibody
ABP-PAB-11314	Allele Biotech	100 ug	Ask for price
Product line: Miscellaneous Brand:

GNAS Conjugated Antibody
C32899	SAB	100ul	EUR 397.00

NESP55,GNAS Antibody
abx235663-100ug	Abbexa	100 ug	EUR 481.00
Shipped within 5-12 working days.

GNAS Antibody (HRP)
20-abx306647	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

GNAS Antibody (FITC)
20-abx306648	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

GNAS Antibody (Biotin)
20-abx306649	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

GNAS Polyclonal Antibody
A68803	EpiGentek	100 ?g	EUR 628.55
Description: Ask the seller for details

GNAS Polyclonal Antibody
A64422	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

anti- GNAS antibody
FNab03536	FN Test	100µg	EUR 505.25
Immunogen: GNAS complex locus Uniprot ID: O95467 Gene ID: 2778 Research Area: Neuroscience, Cancer, Immunology, Signal Transduction
Description: Antibody raised against GNAS

Anti-GNAS antibody
PAab03536	Lifescience Market	100 ug	EUR 355.00

Anti-GNAS antibody
STJ27492	St John's Laboratory	100 µl	EUR 277.00
Description: This locus has a highly complex imprinted expression pattern. It gives rise to maternally, paternally, and biallelically expressed transcripts that are derived from four alternative promoters and 5' exons. Some transcripts contain a differentially methylated region (DMR) at their 5' exons, and this DMR is commonly found in imprinted genes and correlates with transcript expression. An antisense transcript is produced from an overlapping locus on the opposite strand. One of the transcripts produced from this locus, and the antisense transcript, are paternally expressed noncoding RNAs, and may regulate imprinting in this region. In addition, one of the transcripts contains a second overlapping ORF, which encodes a structurally unrelated protein - Alex. Alternative splicing of downstream exons is also observed, which results in different forms of the stimulatory G-protein alpha subunit, a key element of the classical signal transduction pathway linking receptor-ligand interactions with the activation of adenylyl cyclase and a variety of cellular reponses. Multiple transcript variants encoding different isoforms have been found for this gene. Mutations in this gene result in pseudohypoparathyroidism type 1a, pseudohypoparathyroidism type 1b, Albright hereditary osteodystrophy, pseudopseudohypoparathyroidism, McCune-Albright syndrome, progressive osseus heteroplasia, polyostotic fibrous dysplasia of bone, and some pituitary tumors.

Anti-GNAS antibody
STJ23816	St John's Laboratory	100 µl	EUR 277.00
Description: This locus has a highly complex imprinted expression pattern. It gives rise to maternally, paternally, and biallelically expressed transcripts that are derived from four alternative promoters and 5' exons. Some transcripts contain a differentially methylated region (DMR) at their 5' exons, and this DMR is commonly found in imprinted genes and correlates with transcript expression. An antisense transcript is produced from an overlapping locus on the opposite strand. One of the transcripts produced from this locus, and the antisense transcript, are paternally expressed noncoding RNAs, and may regulate imprinting in this region. In addition, one of the transcripts contains a second overlapping ORF, which encodes a structurally unrelated protein - Alex. Alternative splicing of downstream exons is also observed, which results in different forms of the stimulatory G-protein alpha subunit, a key element of the classical signal transduction pathway linking receptor-ligand interactions with the activation of adenylyl cyclase and a variety of cellular reponses. Multiple transcript variants encoding different isoforms have been found for this gene. Mutations in this gene result in pseudohypoparathyroidism type 1a, pseudohypoparathyroidism type 1b, Albright hereditary osteodystrophy, pseudopseudohypoparathyroidism, McCune-Albright syndrome, progressive osseus heteroplasia, polyostotic fibrous dysplasia of bone, and some pituitary tumors.

Anti-GNAS antibody
STJ72252	St John's Laboratory	100 µg	EUR 359.00

Gnas/ Rat Gnas ELISA Kit
ELI-12714r	Lifescience Market	96 Tests	EUR 886.00

Gnas/ Rat Gnas ELISA Kit
ELI-27931r	Lifescience Market	96 Tests	EUR 886.00

Gnas/ Rat Gnas ELISA Kit
ELI-35065r	Lifescience Market	96 Tests	EUR 886.00

Gnas/ Rat Gnas ELISA Kit
ELI-47242r	Lifescience Market	96 Tests	EUR 886.00

GNAS siRNA
20-abx900009	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

GNAS siRNA
20-abx900030	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

GNAS siRNA
20-abx918154	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

GNAS siRNA
20-abx918155	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

GNAS siRNA
20-abx918156	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

GNAS siRNA
20-abx918157	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

GNAS siRNA
20-abx918158	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

GNAS siRNA
20-abx918159	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

GNAS siRNA
20-abx918160	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

GNAS siRNA
20-abx918161	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

pBluescriptR-GNAS
PVT17793	Lifescience Market	2 ug	EUR 231.00

Polyclonal GNAS Antibody (Center)
APR05815G	Leading Biology	0.1ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNAS (Center). This antibody is tested and proven to work in the following applications:

GNAS Antibody, Biotin conjugated
1-CSB-PA352389LD01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GNAS Antibody, HRP conjugated
1-CSB-PA307619LB01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GNAS Antibody, FITC conjugated
1-CSB-PA307619LC01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GNAS Antibody, Biotin conjugated
1-CSB-PA307619LD01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GNAS Antibody, HRP conjugated
1-CSB-PA352389LB01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GNAS Antibody, FITC conjugated
1-CSB-PA352389LC01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAS. Recognizes GNAS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

anti- NESP55,GNAS antibody
FNab05663	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:1000-1:4000 IHC: 1:50-1：500 Immunogen: GNAS complex locus Uniprot ID: O95467 Research Area: cancer, Metabolism
Description: Antibody raised against NESP55,GNAS

Polyclonal GNAS Antibody (C-term)
APR04328G	Leading Biology	0.1ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNAS (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal GNAS Antibody (internal region)
APG00677G	Leading Biology	0.1mg	EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human GNAS (internal region). This antibody is tested and proven to work in the following applications:

Polyclonal GNAS Antibody (aa385-394)
APR02185G	Leading Biology	0.05mg	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNAS (aa385-394). This antibody is tested and proven to work in the following applications:

Monoclonal GNAS Antibody, Clone: 7G6G5
AMM03034G	Leading Biology	0.1ml	EUR 528.00
Description: A Monoclonal antibody against Human GNAS. The antibodies are raised in Mouse and are from clone 7G6G5. This antibody is applicable in WB and IHC, FC, ICC, E

Monoclonal GNAS Antibody, Clone: 2A2B7
AMM03035G	Leading Biology	0.1ml	EUR 528.00
Description: A Monoclonal antibody against Human GNAS. The antibodies are raised in Mouse and are from clone 2A2B7. This antibody is applicable in WB and IHC, FC, ICC, E

Polyclonal GNAS Antibody (N-Term)
AMM04827G	Leading Biology	0.1ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNAS (N-Term). This antibody is tested and proven to work in the following applications:

GNAS Polyclonal Antibody, HRP Conjugated
A68804	EpiGentek	100 ?g	EUR 628.55
Description: The best epigenetics products

GNAS Polyclonal Antibody, FITC Conjugated
A68805	EpiGentek	100 ?g	EUR 628.55
Description: kits suitable for this type of research

GNAS Polyclonal Antibody, Biotin Conjugated
A68806	EpiGentek	100 ?g	EUR 628.55
Description: fast delivery possible

GNAS Polyclonal Antibody, HRP Conjugated
A64423	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

GNAS Polyclonal Antibody, FITC Conjugated
A64424	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

GNAS Polyclonal Antibody, Biotin Conjugated
A64425	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

GNAS Blocking Peptide
33R-10097	Fitzgerald	100 ug	EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAS antibody, catalog no. 70R-1651

GNAS Blocking Peptide
33R-8471	Fitzgerald	100 ug	EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAS antibody, catalog no. 70R-1652

GNAS Blocking Peptide
33R-9925	Fitzgerald	100 ug	EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAS antibody, catalog no. 70R-5756

GNAS Blocking Peptide
33R-6814	Fitzgerald	100 ug	EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAS antibody, catalog no. 70R-1643

GNAS Blocking Peptide
DF7068-BP	Affbiotech	1mg	EUR 195.00

GNAS Blocking Peptide
DF7388-BP	Affbiotech	1mg	EUR 195.00

GNAS cloning plasmid
CSB-CL009596HU1-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1185 Sequence: atgggctgcctcgggaacagtaagaccgaggaccagcgcaacgaggagaaggcgcagcgtgaggccaacaaaaagatcgagaagcagctgcagaaggacaagcaggtctaccgggccacgcaccgcctgctgctgctgggtgctggagaatctggtaaaagcaccattgtgaagc Show more
Description: A cloning plasmid for the GNAS gene.

GNAS cloning plasmid
CSB-CL009596HU2-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1188 Sequence: atgggctgcctcgggaacagtaagaccgaggaccagcgcaacgaggagaaggcgcagcgtgaggccaacaaaaagatcgagaagcagctgcagaaggacaagcaggtctaccgggccacgcaccgcctgctgctgctgggtgctggagaatctggtaaaagcaccattgtgaagc Show more
Description: A cloning plasmid for the GNAS gene.

GNAS Rabbit pAb
A5546-100ul	Abclonal	100 ul	EUR 308.00

GNAS Rabbit pAb
A5546-200ul	Abclonal	200 ul	EUR 459.00

GNAS Rabbit pAb
A5546-20ul	Abclonal	20 ul	EUR 183.00

GNAS Rabbit pAb
A5546-50ul	Abclonal	50 ul	EUR 223.00

GNAS Rabbit pAb
A2732-100ul	Abclonal	100 ul	EUR 308.00

GNAS Rabbit pAb
A2732-200ul	Abclonal	200 ul	EUR 459.00

GNAS Rabbit pAb
A2732-20ul	Abclonal	20 ul	EUR 183.00

GNAS Rabbit pAb
A2732-50ul	Abclonal	50 ul	EUR 223.00

Recombinant human GNAS
P1012	FN Test	100ug	Ask for price
Uniprot ID: O95467 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human GNAS

pSV40- Gnas- m
PVT11671	Lifescience Market	2 ug	EUR 273.00

Human GNAS ELISA KIT
ELI-12712h	Lifescience Market	96 Tests	EUR 824.00

Mouse Gnas ELISA KIT
ELI-12713m	Lifescience Market	96 Tests	EUR 865.00

Canine GNAS ELISA KIT
ELI-27250d	Lifescience Market	96 Tests	EUR 928.00

GNAS ELISA KIT|Human
EF009911	Lifescience Market	96 Tests	EUR 689.00

Rat GNAS shRNA Plasmid
20-abx984695	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Rat GNAS shRNA Plasmid
20-abx984696	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Human GNAS shRNA Plasmid
20-abx951847	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Human GNAS shRNA Plasmid
20-abx951848	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Human GNAS shRNA Plasmid
20-abx951849	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Human GNAS shRNA Plasmid
20-abx951850	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Mouse GNAS shRNA Plasmid
20-abx970580	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Mouse GNAS shRNA Plasmid
20-abx970581	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Mouse GNAS shRNA Plasmid
20-abx970582	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Mouse GNAS shRNA Plasmid
20-abx970583	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Bovine GNAS ELISA KIT
ELI-38027b	Lifescience Market	96 Tests	EUR 928.00

Mouse Gnas ELISA KIT
ELI-48020m	Lifescience Market	96 Tests	EUR 865.00

Human GNAS ELISA KIT
ELI-48772h	Lifescience Market	96 Tests	EUR 824.00

NESP55/GNAS ELISA KIT|Human
EF001179	Lifescience Market	96 Tests	EUR 689.00

Gnas ORF Vector (Rat) (pORF)
ORF067655	ABM	1.0 ug DNA	EUR 506.00

Gnas ORF Vector (Rat) (pORF)
ORF067656	ABM	1.0 ug DNA	EUR 506.00

Gnas ORF Vector (Rat) (pORF)
ORF067657	ABM	1.0 ug DNA	EUR 506.00

Gnas ORF Vector (Rat) (pORF)
ORF067658	ABM	1.0 ug DNA	EUR 506.00

Gnas ORF Vector (Rat) (pORF)
ORF067659	ABM	1.0 ug DNA	EUR 506.00

GNAS ORF Vector (Human) (pORF)
ORF004496	ABM	1.0 ug DNA	EUR 95.00

GNAS ORF Vector (Human) (pORF)
ORF004497	ABM	1.0 ug DNA	EUR 95.00

Gnas ORF Vector (Mouse) (pORF)
ORF046308	ABM	1.0 ug DNA	EUR 506.00

Gnas ORF Vector (Mouse) (pORF)
ORF046309	ABM	1.0 ug DNA	EUR 506.00

Gnas ORF Vector (Mouse) (pORF)
ORF046310	ABM	1.0 ug DNA	EUR 506.00

Gnas ORF Vector (Mouse) (pORF)
ORF046311	ABM	1.0 ug DNA	EUR 506.00

Gnas ORF Vector (Mouse) (pORF)
ORF046312	ABM	1.0 ug DNA	EUR 506.00

Gnas ORF Vector (Mouse) (pORF)
ORF046313	ABM	1.0 ug DNA	EUR 506.00

Gnas ORF Vector (Mouse) (pORF)
ORF046314	ABM	1.0 ug DNA	EUR 506.00

Gnas ORF Vector (Mouse) (pORF)
ORF046315	ABM	1.0 ug DNA	EUR 506.00

Mouse Protein ALEX, Gnas ELISA KIT
ELI-24352m	Lifescience Market	96 Tests	EUR 865.00

Human Protein ALEX, GNAS ELISA KIT
ELI-24547h	Lifescience Market	96 Tests	EUR 824.00

Gnas sgRNA CRISPR Lentivector set (Rat)
K7535001	ABM	3 x 1.0 ug	EUR 339.00

Gnas sgRNA CRISPR Lentivector set (Mouse)
K4363501	ABM	3 x 1.0 ug	EUR 339.00

GNAS sgRNA CRISPR Lentivector set (Human)
K0875301	ABM	3 x 1.0 ug	EUR 339.00

GNAS-AS1 ORF Vector (Human) (pORF)
ORF020250	ABM	1.0 ug DNA	EUR 95.00

pECMV-3脳FLAG-GNAS vector
PVT12057	Lifescience Market	2 ug	EUR 352.00

Mouse Neuroendocrine Secretory Protein (GNAS) ELISA Kit
abx392277-96tests	Abbexa	96 tests	EUR 911.00
Shipped within 5-12 working days.

Rat Neuroendocrine Secretory Protein (GNAS) ELISA Kit
abx392284-96tests	Abbexa	96 tests	EUR 911.00
Shipped within 5-12 working days.

Human Neuroendocrine Secretory Protein (GNAS) ELISA Kit
abx387603-96tests	Abbexa	96 tests	EUR 911.00
Shipped within 5-12 working days.

Gnas sgRNA CRISPR Lentivector (Rat) (Target 1)
K7535002	ABM	1.0 ug DNA	EUR 154.00

Gnas sgRNA CRISPR Lentivector (Rat) (Target 2)
K7535003	ABM	1.0 ug DNA	EUR 154.00

Gnas sgRNA CRISPR Lentivector (Rat) (Target 3)
K7535004	ABM	1.0 ug DNA	EUR 154.00

Gnas sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4363502	ABM	1.0 ug DNA	EUR 154.00

Gnas sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4363503	ABM	1.0 ug DNA	EUR 154.00

Gnas sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4363504	ABM	1.0 ug DNA	EUR 154.00

GNAS sgRNA CRISPR Lentivector (Human) (Target 1)
K0875302	ABM	1.0 ug DNA	EUR 154.00

GNAS sgRNA CRISPR Lentivector (Human) (Target 2)
K0875303	ABM	1.0 ug DNA	EUR 154.00

GNAS sgRNA CRISPR Lentivector (Human) (Target 3)
K0875304	ABM	1.0 ug DNA	EUR 154.00

GNAS Protein Vector (Rat) (pPB-C-His)
PV270618	ABM	500 ng	EUR 603.00

GNAS Protein Vector (Rat) (pPB-N-His)
PV270619	ABM	500 ng	EUR 603.00

GNAS Protein Vector (Rat) (pPM-C-HA)
PV270620	ABM	500 ng	EUR 603.00

GNAS Protein Vector (Rat) (pPM-C-His)
PV270621	ABM	500 ng	EUR 603.00

GNAS Protein Vector (Rat) (pPB-C-His)
PV270622	ABM	500 ng	EUR 603.00

GNAS Protein Vector (Rat) (pPB-N-His)
PV270623	ABM	500 ng	EUR 603.00

GNAS Protein Vector (Rat) (pPM-C-HA)
PV270624	ABM	500 ng	EUR 603.00

GNAS Protein Vector (Rat) (pPM-C-His)
PV270625	ABM	500 ng	EUR 603.00

GNAS Protein Vector (Rat) (pPB-C-His)
PV270626	ABM	500 ng	EUR 1166.00

GNAS Protein Vector (Rat) (pPB-N-His)
PV270627	ABM	500 ng	EUR 1166.00

GNAS Protein Vector (Rat) (pPM-C-HA)
PV270628	ABM	500 ng	EUR 1166.00

GNAS Protein Vector (Rat) (pPM-C-His)
PV270629	ABM	500 ng	EUR 1166.00

GNAS Protein Vector (Rat) (pPB-C-His)
PV270630	ABM	500 ng	EUR 1166.00

GNAS Protein Vector (Rat) (pPB-N-His)
PV270631	ABM	500 ng	EUR 1166.00

GNAS Protein Vector (Rat) (pPM-C-HA)
PV270632	ABM	500 ng	EUR 1166.00

GNAS Protein Vector (Rat) (pPM-C-His)
PV270633	ABM	500 ng	EUR 1166.00

GNAS Protein Vector (Rat) (pPB-C-His)
PV270634	ABM	500 ng	EUR 603.00

GNAS Protein Vector (Rat) (pPB-N-His)
PV270635	ABM	500 ng	EUR 603.00

GNAS Protein Vector (Rat) (pPM-C-HA)
PV270636	ABM	500 ng	EUR 603.00

GNAS Protein Vector (Rat) (pPM-C-His)
PV270637	ABM	500 ng	EUR 603.00

GNAS Protein Vector (Mouse) (pPB-C-His)
PV185230	ABM	500 ng	EUR 603.00

GNAS Protein Vector (Mouse) (pPB-N-His)
PV185231	ABM	500 ng	EUR 603.00

GNAS Protein Vector (Mouse) (pPM-C-HA)
PV185232	ABM	500 ng	EUR 603.00

GNAS Protein Vector (Mouse) (pPM-C-His)
PV185233	ABM	500 ng	EUR 603.00

GNAS Protein Vector (Mouse) (pPB-C-His)
PV185234	ABM	500 ng	EUR 603.00

GNAS Protein Vector (Mouse) (pPB-N-His)
PV185235	ABM	500 ng	EUR 603.00

GNAS Protein Vector (Mouse) (pPM-C-HA)
PV185236	ABM	500 ng	EUR 603.00

GNAS Protein Vector (Mouse) (pPM-C-His)
PV185237	ABM	500 ng	EUR 603.00

GNAS Protein Vector (Mouse) (pPB-C-His)
PV185238	ABM	500 ng	EUR 1065.00

GNAS Protein Vector (Mouse) (pPB-N-His)
PV185239	ABM	500 ng	EUR 1065.00

GNAS Protein Vector (Mouse) (pPM-C-HA)
PV185240	ABM	500 ng	EUR 1065.00

GNAS Protein Vector (Mouse) (pPM-C-His)
PV185241	ABM	500 ng	EUR 1065.00

GNAS Protein Vector (Mouse) (pPB-C-His)
PV185242	ABM	500 ng	EUR 1065.00

GNAS Protein Vector (Mouse) (pPB-N-His)
PV185243	ABM	500 ng	EUR 1065.00

GNAS Protein Vector (Mouse) (pPM-C-HA)
PV185244	ABM	500 ng	EUR 1065.00

GNAS Protein Vector (Mouse) (pPM-C-His)
PV185245	ABM	500 ng	EUR 1065.00

GNAS Protein Vector (Mouse) (pPB-C-His)
PV185246	ABM	500 ng	EUR 1065.00

GNAS Protein Vector (Mouse) (pPB-N-His)
PV185247	ABM	500 ng	EUR 1065.00

GNAS Protein Vector (Mouse) (pPM-C-HA)
PV185248	ABM	500 ng	EUR 1065.00

GNAS Protein Vector (Mouse) (pPM-C-His)
PV185249	ABM	500 ng	EUR 1065.00

GNAS Protein Vector (Mouse) (pPB-C-His)
PV185250	ABM	500 ng	EUR 1065.00

GNAS Protein Vector (Mouse) (pPB-N-His)
PV185251	ABM	500 ng	EUR 1065.00

GNAS Protein Vector (Mouse) (pPM-C-HA)
PV185252	ABM	500 ng	EUR 1065.00

GNAS Protein Vector (Mouse) (pPM-C-His)
PV185253	ABM	500 ng	EUR 1065.00

RNA-Binding Proteins in Most cancers: Practical and Therapeutic Views

 

RNA-binding proteins (RBPs) crucially regulate gene expression by post-transcriptional regulation, akin to by modulating microRNA (miRNA) processing and the choice splicing, different polyadenylation, subcellular localization, stability, and translation of RNAs. Greater than 1500 RBPs have been recognized so far, and plenty of of them are recognized to be deregulated in most cancers. Alterations within the expression and localization of RBPs can affect the expression ranges of oncogenes, tumor-suppressor genes, and genome stability-related genes.

RBP-mediated gene regulation can result in numerous cancer-related mobile phenotypes, akin to proliferation, apoptosis, angiogenesis, senescence, and epithelial-mesenchymal transition (EMT)/invasion/metastasis. This regulation can be related to most cancers prognosis.

Thus, RBPs could be potential targets for the event of therapeutics for the most cancers therapy. On this overview, we describe the molecular features of RBPs, their roles in cancer-related mobile phenotypes, and numerous approaches that could be used to focus on RBPs for most cancers therapy.

 

Circulating Lengthy Non-Coding RNA GAS5 Is Overexpressed in Serum from Osteoporotic Sufferers and Is Related to Elevated Danger of Bone Fragility

 

Osteoporosis (OP) is a multifactorial dysfunction through which environmental elements together with genetic variants and epigenetic mechanisms have been implicated. Lengthy non-coding RNAs (lncRNAs) have just lately emerged as essential regulators of bone metabolism and OP aetiology.

On this research, we analyzed the expression degree and the genetic affiliation of lncRNA GAS5 in OP sufferers in comparison with controls. Quantitative RT-PCR evaluation of GAS5 was carried out on the serum of 56 OP sufferers and 28 wholesome people. OP topics had been divided into three teams of research: 29 with fragility fractures of lumbar backbone (OP_VF), 14 with fragility fractures of femoral neck (OP_FF) and 13 with out fractures (OP_WF). Genotyping of the rs145204276 insertion/deletion polymorphism has additionally been carried out by Restriction fragment size polymorphism (RFLP) and direct sequencing analyses.

Expression of circulating GAS5 is considerably elevated in OP sufferers in comparison with controls (p < 0.01), with a statistically greater significance in fractured OP people vs. wholesome topics (p < 0.001). No statistically important change was present in feminine OP sufferers; conversely, GAS5 is upregulated within the subgroup of fractured OP ladies sera (p < 0.01) and in all OP males (p < 0.05). Moreover, a direct correlation between GAS5 expression degree and parathyroid hormone (PTH) focus was present in OP sufferers (r = 0.2930; p = 0.0389).

Genetic evaluation of rs145204276 revealed that the deletion allele was correlated with the next expression of GAS5 in OP sufferers (0.22 ± 0.02 vs. 0.15 ± 0.01, ** p < 0.01). Our outcomes recommend circulating GAS5 as a putative biomarker for the prognosis and prognosis of OP and OP-related fractures.

 

Rat Sex Determining Region Y Box Protein 2 (SOX2) ELISA Kit
RD-SOX2-Ra-96Tests	Reddot Biotech	96 Tests	EUR 709.00

Rat Sex Determining Region Y Box Protein 2 (SOX2) ELISA Kit
RDR-SOX2-Ra-48Tests	Reddot Biotech	48 Tests	EUR 534.00

Rat Sex Determining Region Y Box Protein 2 (SOX2) ELISA Kit
RDR-SOX2-Ra-96Tests	Reddot Biotech	96 Tests	EUR 742.00

SOX2 Antibody
25044-100ul	SAB	100ul	EUR 390.00

Sox2 antibody
20R-1751	Fitzgerald	100 ug	EUR 673.00
Description: Rabbit polyclonal Sox2 antibody

SOX2 antibody
20R-2500	Fitzgerald	50 ug	EUR 281.00
Description: Rabbit polyclonal SOX2 antibody

SOX2 Antibody
21425-100ul	SAB	100ul	EUR 252.00

SOX2 Antibody
21425-50ul	SAB	50ul	EUR 187.00

SOX2 Antibody
31128-100ul	SAB	100ul	EUR 252.00

SOX2 Antibody
31128-50ul	SAB	50ul	EUR 187.00

SOX2 antibody
70R-12166	Fitzgerald	100 ug	EUR 403.00
Description: Rabbit polyclonal SOX2 antibody

SOX2 antibody
70R-20460	Fitzgerald	50 ul	EUR 435.00
Description: Rabbit polyclonal SOX2 antibody

SOX2 Antibody
48128-100ul	SAB	100ul	EUR 333.00

SOX2 Antibody
48128-50ul	SAB	50ul	EUR 239.00

SOX2 antibody
38134-100ul	SAB	100ul	EUR 252.00

SOX2 antibody
10R-11127	Fitzgerald	100 ug	EUR 349.00
Description: Mouse monoclonal SOX2 antibody

SOX2 Antibody
43142-100ul	SAB	100ul	EUR 252.00

SOX2 Antibody
CSB-PA982860-	Cusabio		EUR 335.00
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo Show more
Description: A polyclonal antibody against SOX2. Recognizes SOX2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

SOX2 Antibody
CSB-PA982860-100ul	Cusabio	100ul	EUR 316.00
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo Show more
Description: A polyclonal antibody against SOX2. Recognizes SOX2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

SOX2 Antibody
1-CSB-PA698932	Cusabio	EUR 317.00 EUR 244.00	0 1
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SOX2. Recognizes SOX2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

SOX2 Antibody
DF6109	Affbiotech	200ul	EUR 304.00
Description: SOX2 Antibody detects endogenous levels of total SOX2.

SOX2 Antibody
1-CSB-PA588368	Cusabio	EUR 317.00 EUR 244.00	0 1
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SOX2. Recognizes SOX2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:15-1:50

SOX2 Antibody
1-CSB-PA16539A0Rb	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SOX2. Recognizes SOX2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

Sox2 antibody
70R-SR013	Fitzgerald	100 ug	EUR 300.00
Description: Affinity purified Rabbit polyclonal Sox2 antibody

SOX2 antibody
70R-33158	Fitzgerald	100 ug	EUR 435.00
Description: Rabbit polyclonal SOX2 antibody

SOX2 antibody
70R-33160	Fitzgerald	100 ug	EUR 435.00
Description: Rabbit polyclonal SOX2 antibody

SOX2 Antibody
AF4010	Affbiotech	200ul	EUR 376.00
Description: The antibody detects endogenous level of total SOX2 protein.

SOX2 Antibody
AF5140	Affbiotech	200ul	EUR 304.00
Description: SOX2 Antibody detects endogenous levels of total SOX2.

SOX2 Antibody
BF0481	Affbiotech	200ul	EUR 376.00
Description: SOX2 antibody detects endogenous levels of total SOX2.

SOX2 Antibody
1-CSB-PA022426GA01HU	Cusabio	EUR 597.00 EUR 333.00	0 1
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SOX2. Recognizes SOX2 from Human, Mouse, Rat, Zebrafish. This antibody is Unconjugated. Tested in the following application: ELISA, IF

sox2 Antibody
AF7950	Affbiotech	200ul	EUR 376.00
Description: sox2 Antibody detects endogenous levels of sox2.

SOX2 Antibody
ABD6109	Lifescience Market	100 ug	EUR 438.00

SOX2 Antibody
ABF4010	Lifescience Market	100 ug	EUR 438.00

SOX2 Antibody
ABF5140	Lifescience Market	100 ug	EUR 438.00

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNUM1791-50	Biotium	50uL	EUR 395.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791), 1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNUM1792-50	Biotium	50uL	EUR 395.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792), 1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNUB1791-100	Biotium	100uL	EUR 209.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791), Concentration: 0.2mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNUB1791-500	Biotium	500uL	EUR 458.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791), Concentration: 0.2mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNUB1792-100	Biotium	100uL	EUR 209.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792), Concentration: 0.2mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNUB1792-500	Biotium	500uL	EUR 458.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792), Concentration: 0.2mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC551791-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF555 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC551791-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF555 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC551792-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF555 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC551792-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF555 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC611791-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF660R conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC611791-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF660R conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC611792-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF660R conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC611792-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF660R conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC471791-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF647 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC471791-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF647 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC471792-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF647 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC471792-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF647 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC051791-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF405M conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC051791-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF405M conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC051792-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF405M conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC051792-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF405M conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC401791-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF640R conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC401791-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF640R conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC401792-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF640R conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC401792-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF640R conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC431791-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF543 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC431791-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF543 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC431792-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF543 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC431792-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF543 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC041791-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF405S conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC041791-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF405S conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC041792-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF405S conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC041792-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF405S conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC701791-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF770 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC701791-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF770 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC701792-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF770 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC701792-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF770 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC801791-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF680 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC801791-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF680 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC801792-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF680 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC801792-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF680 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNCH1791-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNCH1791-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNCH1792-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNCH1792-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNCP1791-250	Biotium	250uL	EUR 383.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),PerCP conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNCP1792-250	Biotium	250uL	EUR 383.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),PerCP conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNCR1791-250	Biotium	250uL	EUR 383.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),RPE conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNCR1792-250	Biotium	250uL	EUR 383.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),RPE conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC941791-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF594 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC941791-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF594 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC941792-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF594 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC941792-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF594 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNCA1791-250	Biotium	250uL	EUR 383.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),APC conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNCA1792-250	Biotium	250uL	EUR 383.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),APC conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNCB1791-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),Biotin conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNCB1791-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),Biotin conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNCB1792-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),Biotin conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNCB1792-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),Biotin conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC881791-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF488A conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC881791-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF488A conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC881792-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF488A conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC881792-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF488A conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC681791-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF568 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC681791-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF568 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC681792-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF568 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC681792-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF568 conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNCAP1791-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNCAP1791-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNCAP1792-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNCAP1792-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC811791-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF680R conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC811791-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF680R conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC811792-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF680R conjugate, Concentration: 0.1mg/mL

SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC811792-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF680R conjugate, Concentration: 0.1mg/mL

SOX2
GT15098	Neuromics	100 ug.	EUR 539.00

SOX2
P25021	Neuromics	50 ul. Blocking Peptide	EUR 174.00

SOX2
MO15040	Neuromics	100 ug	EUR 435.00

SOX2
RA25021	Neuromics	100 ul	EUR 409.00

SOX2 Monoclonal Antibody
27015-100ul	SAB	100ul	EUR 252.00

SOX2 Monoclonal Antibody
27015-50ul	SAB	50ul	EUR 187.00

Human SOX2 Antibody
32612-05111	AssayPro	150 ug	EUR 261.00

SOX2 (pS83) Antibody
abx032060-400ul	Abbexa	400 ul	EUR 523.00
Shipped within 5-10 working days.

SOX2 (pS83) Antibody
abx032060-80l	Abbexa	80 µl	EUR 286.00
Shipped within 5-10 working days.

Sox2 (pS249) Antibody
abx032092-400ul	Abbexa	400 ul	EUR 523.00
Shipped within 5-10 working days.

Sox2 (pS249) Antibody
abx032092-80l	Abbexa	80 µl	EUR 286.00
Shipped within 5-10 working days.

Sox2 (pS251) Antibody
abx032097-400ul	Abbexa	400 ul	EUR 523.00
Shipped within 5-10 working days.

Sox2 (pS251) Antibody
abx032097-80l	Abbexa	80 µl	EUR 286.00
Shipped within 5-10 working days.

Sox2 (pS246) Antibody
abx032105-400ul	Abbexa	400 ul	EUR 523.00
Shipped within 5-10 working days.

Sox2 (pS246) Antibody
abx032105-80l	Abbexa	80 µl	EUR 286.00
Shipped within 5-10 working days.

Polyclonal SOX2 Antibody
APR13481G	Leading Biology	0.1ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SOX2 . This antibody is tested and proven to work in the following applications:

Polyclonal SOX2 Antibody
APR13484G	Leading Biology	0.1 mg	EUR 659.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SOX2 . This antibody is tested and proven to work in the following applications:

Monoclonal Sox2 Antibody
APR13485G	Leading Biology	0.1ml	EUR 484.00
Description: A Monoclonal antibody against Human Sox2. The antibodies are raised in Mouse. This antibody is applicable in WB, ICC, FC

SOX2 Conjugated Antibody
C43142	SAB	100ul	EUR 397.00

SOX2 Conjugated Antibody
C21425	SAB	100ul	EUR 397.00

SOX2 Conjugated Antibody
C31128	SAB	100ul	EUR 397.00

SOX2 Polyclonal Antibody
A54440	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

anti- SOX2 antibody
FNab08125	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:2000-1:20000 IHC: 1:50-1:200 IF: 1:50-1:500 Immunogen: SRY(sex determining region Y)-box 2 Uniprot ID: P48431 Gene ID: 6657 Research Area: Neuroscience, Stem Cells, Metabolism, Epigenetics
Description: Antibody raised against SOX2

anti- SOX2 antibody
FNab08126	FN Test	100µg	EUR 505.25
Immunogen: SRY(sex determining region Y)-box 2 Uniprot ID: P48431 Gene ID: 6657 Research Area: Neuroscience, Stem Cells, Metabolism, Epigenetics
Description: Antibody raised against SOX2

anti- SOX2 antibody
FNab10148	FN Test	100µg	EUR 585.00
Recommended dilution: WB: 1:500-1:2000 IHC: 1:50-1:200 Immunogen: SRY(sex determining region Y)-box 2 Uniprot ID: P48431 Gene ID: 6657 Research Area: Neuroscience, Stem Cells, Metabolism, Epigenetics
Description: Antibody raised against SOX2

Anti-SOX2 Antibody
PA2284	BosterBio	100ug/vial	EUR 334.00

Anti-SOX2 antibody
PAab08125	Lifescience Market	100 ug	EUR 355.00

Anti-SOX2 antibody
PAab08126	Lifescience Market	100 ug	EUR 355.00

Anti-SOX2 antibody
STJ25661	St John's Laboratory	100 µl	EUR 277.00
Description: This intronless gene encodes a member of the SRY-related HMG-box (SOX) family of transcription factors involved in the regulation of embryonic development and in the determination of cell fate. The product of this gene is required for stem-cell maintenance in the central nervous system, and also regulates gene expression in the stomach. Mutations in this gene have been associated with optic nerve hypoplasia and with syndromic microphthalmia, a severe form of structural eye malformation. This gene lies within an intron of another gene called SOX2 overlapping transcript (SOX2OT).

Anti-SOX2 antibody
STJ113816	St John's Laboratory	100 µl	EUR 277.00
Description: This intronless gene encodes a member of the SRY-related HMG-box (SOX) family of transcription factors involved in the regulation of embryonic development and in the determination of cell fate. The product of this gene is required for stem-cell maintenance in the central nervous system, and also regulates gene expression in the stomach. Mutations in this gene have been associated with optic nerve hypoplasia and with syndromic microphthalmia, a severe form of structural eye malformation. This gene lies within an intron of another gene called SOX2 overlapping transcript (SOX2OT).

Anti-SOX2 antibody
STJ160068	St John's Laboratory	7 mL P	EUR 402.00
Description: SOX 2, also known as SRY (sex determining region Y)-box 2, is a transcription factor that acts to regulate pluripotency of undifferentiated embryonic stem cells, and to regulate gene expression in the stomach. This diagnostic grade SOX 2 IVD antibody is used to detect melanoma, testicular germ cell tumor, cervical carcinoma, lung cancer, breast cancer with basal cell phenotype, and teratoma of the central nervous system. SOX 2 has been reported as a predictor of poor outcome in stage I lung adenocarcinomas. Anti-SOX 2 is also used to recognize squamous cell carcinomas of the lung and gastrointestinal tract, and may be useful for detecting embryonal carcinoma.

Anti-SOX2 antibody
STJ73592	St John's Laboratory	100 µg	EUR 359.00

Anti-SOX2 antibody
STJ73611	St John's Laboratory	100 µg	EUR 359.00

Anti-SOX2 Antibody
STJ503092	St John's Laboratory	100 µg	EUR 476.00

Anti-SOX2 Antibody
STJ503093	St John's Laboratory	100 µg	EUR 476.00

Anti-Sox2 antibody
STJ99043	St John's Laboratory	200 µl	EUR 197.00
Description: Mouse monoclonal to Sox2.

Anti-SOX2 Antibody Clone SOX2/1791, Unconjugated-20ug
6657-MSM1-P0	EnQuireBio	20ug	EUR 233.00

Anti-SOX2 Antibody Clone SOX2/1791, Unconjugated-100ug
6657-MSM1-P1	EnQuireBio	100ug	EUR 428.00

Anti-SOX2 Antibody Clone SOX2/1792, Unconjugated-20ug
6657-MSM2-P0	EnQuireBio	20ug	EUR 233.00

Anti-SOX2 Antibody Clone SOX2/1792, Unconjugated-100ug
6657-MSM2-P1	EnQuireBio	100ug	EUR 428.00

Sox2 protein
30R-AS055	Fitzgerald	25 ug	EUR 273.00
Description: Purified recombinant Human Sox2 protein

SOX2 siRNA
20-abx934728	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

SOX2 siRNA
20-abx934729	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

pMXs- Sox2
PVT10444	Lifescience Market	2 ug	EUR 301.00

SOX2 Plasmid
PVT7186	Lifescience Market	2 ug	EUR 266.00

anti-SOX2
YF-PA14740	Abfrontier	100 ug	EUR 403.00
Description: Rabbit polyclonal to SOX2

anti-SOX2
YF-PA24750	Abfrontier	50 ul	EUR 334.00
Description: Mouse polyclonal to SOX2

SOX2 Antibody, HRP conjugated
1-CSB-PA16539B0Rb	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SOX2. Recognizes SOX2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SOX2 Antibody, FITC conjugated
1-CSB-PA16539C0Rb	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SOX2. Recognizes SOX2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SOX2 Antibody, Biotin conjugated
1-CSB-PA16539D0Rb	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SOX2. Recognizes SOX2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Polyclonal SOX2 Antibody (Center)
APR13460G	Leading Biology	0.1ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SOX2 (Center). This antibody is tested and proven to work in the following applications:

Polyclonal SOX2 Antibody (A30)
APR13486G	Leading Biology	0.1ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SOX2 (A30). This antibody is tested and proven to work in the following applications:

Polyclonal SOX2 Antibody (C265)
APR13489G	Leading Biology	0.1ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SOX2 (C265). This antibody is tested and proven to work in the following applications:

Antibody for Human SOX2
SPC-1287D	Stressmarq	0.1ml	EUR 314.00
The SOX (SRY-box containing gene) gene family encodes a group of transcription factors defined by the conserved high motility group (HMG) DNA-binding domain. They are involved in the regulation of embryonic development when it forms complexes with Oc Show more
Description: A polyclonal antibody for SOX2 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human SOX2. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This SOX2 antibody is unconjugated.

Antibody for Human SOX2
SPC-1287D-A390	Stressmarq	0.1ml	EUR 361.00
The SOX (SRY-box containing gene) gene family encodes a group of transcription factors defined by the conserved high motility group (HMG) DNA-binding domain. They are involved in the regulation of embryonic development when it forms complexes with Oc Show more
Description: A polyclonal antibody for SOX2 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human SOX2. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This SOX2 antibody is conjugated to ATTO 390.

Antibody for Human SOX2
SPC-1287D-A488	Stressmarq	0.1ml	EUR 360.00
The SOX (SRY-box containing gene) gene family encodes a group of transcription factors defined by the conserved high motility group (HMG) DNA-binding domain. They are involved in the regulation of embryonic development when it forms complexes with Oc Show more
Description: A polyclonal antibody for SOX2 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human SOX2. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This SOX2 antibody is conjugated to ATTO 488.

Antibody for Human SOX2
SPC-1287D-A565	Stressmarq	0.1ml	EUR 360.00
The SOX (SRY-box containing gene) gene family encodes a group of transcription factors defined by the conserved high motility group (HMG) DNA-binding domain. They are involved in the regulation of embryonic development when it forms complexes with Oc Show more
Description: A polyclonal antibody for SOX2 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human SOX2. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This SOX2 antibody is conjugated to ATTO 565.

Antibody for Human SOX2
SPC-1287D-A594	Stressmarq	0.1ml	EUR 360.00
The SOX (SRY-box containing gene) gene family encodes a group of transcription factors defined by the conserved high motility group (HMG) DNA-binding domain. They are involved in the regulation of embryonic development when it forms complexes with Oc Show more
Description: A polyclonal antibody for SOX2 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human SOX2. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This SOX2 antibody is conjugated to ATTO 594.

Antibody for Human SOX2
SPC-1287D-A633	Stressmarq	0.1ml	EUR 360.00
The SOX (SRY-box containing gene) gene family encodes a group of transcription factors defined by the conserved high motility group (HMG) DNA-binding domain. They are involved in the regulation of embryonic development when it forms complexes with Oc Show more
Description: A polyclonal antibody for SOX2 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human SOX2. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This SOX2 antibody is conjugated to ATTO 633.

Antibody for Human SOX2
SPC-1287D-A655	Stressmarq	0.1ml	EUR 360.00
The SOX (SRY-box containing gene) gene family encodes a group of transcription factors defined by the conserved high motility group (HMG) DNA-binding domain. They are involved in the regulation of embryonic development when it forms complexes with Oc Show more
Description: A polyclonal antibody for SOX2 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human SOX2. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This SOX2 antibody is conjugated to ATTO 655.

Antibody for Human SOX2
SPC-1287D-A680	Stressmarq	0.1ml	EUR 360.00
The SOX (SRY-box containing gene) gene family encodes a group of transcription factors defined by the conserved high motility group (HMG) DNA-binding domain. They are involved in the regulation of embryonic development when it forms complexes with Oc Show more
Description: A polyclonal antibody for SOX2 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human SOX2. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This SOX2 antibody is conjugated to ATTO 680.

Antibody for Human SOX2
SPC-1287D-A700	Stressmarq	0.1ml	EUR 360.00
The SOX (SRY-box containing gene) gene family encodes a group of transcription factors defined by the conserved high motility group (HMG) DNA-binding domain. They are involved in the regulation of embryonic development when it forms complexes with Oc Show more
Description: A polyclonal antibody for SOX2 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human SOX2. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This SOX2 antibody is conjugated to ATTO 700.

Antibody for Human SOX2
SPC-1287D-ALP	Stressmarq	0.1ml	EUR 355.00
The SOX (SRY-box containing gene) gene family encodes a group of transcription factors defined by the conserved high motility group (HMG) DNA-binding domain. They are involved in the regulation of embryonic development when it forms complexes with Oc Show more
Description: A polyclonal antibody for SOX2 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human SOX2. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This SOX2 antibody is conjugated to Alkaline Phosphatase.

Antibody for Human SOX2
SPC-1287D-APC	Stressmarq	0.1ml	EUR 359.00
The SOX (SRY-box containing gene) gene family encodes a group of transcription factors defined by the conserved high motility group (HMG) DNA-binding domain. They are involved in the regulation of embryonic development when it forms complexes with Oc Show more
Description: A polyclonal antibody for SOX2 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human SOX2. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This SOX2 antibody is conjugated to APC .

Antibody for Human SOX2
SPC-1287D-APCCY7	Stressmarq	0.1ml	EUR 432.00
The SOX (SRY-box containing gene) gene family encodes a group of transcription factors defined by the conserved high motility group (HMG) DNA-binding domain. They are involved in the regulation of embryonic development when it forms complexes with Oc Show more
Description: A polyclonal antibody for SOX2 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human SOX2. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This SOX2 antibody is conjugated to APC/Cy7.

Antibody for Human SOX2
SPC-1287D-BI	Stressmarq	0.1ml	EUR 357.00
The SOX (SRY-box containing gene) gene family encodes a group of transcription factors defined by the conserved high motility group (HMG) DNA-binding domain. They are involved in the regulation of embryonic development when it forms complexes with Oc Show more
Description: A polyclonal antibody for SOX2 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human SOX2. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This SOX2 antibody is conjugated to Biotin.

Antibody for Human SOX2
SPC-1287D-DY350	Stressmarq	0.1ml	EUR 436.00
The SOX (SRY-box containing gene) gene family encodes a group of transcription factors defined by the conserved high motility group (HMG) DNA-binding domain. They are involved in the regulation of embryonic development when it forms complexes with Oc Show more
Description: A polyclonal antibody for SOX2 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human SOX2. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This SOX2 antibody is conjugated to Dylight 350.

Antibody for Human SOX2
SPC-1287D-DY405	Stressmarq	0.1ml	EUR 412.00
The SOX (SRY-box containing gene) gene family encodes a group of transcription factors defined by the conserved high motility group (HMG) DNA-binding domain. They are involved in the regulation of embryonic development when it forms complexes with Oc Show more
Description: A polyclonal antibody for SOX2 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human SOX2. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This SOX2 antibody is conjugated to Dylight 405.

Antibody for Human SOX2
SPC-1287D-DY488	Stressmarq	0.1ml	EUR 393.00
The SOX (SRY-box containing gene) gene family encodes a group of transcription factors defined by the conserved high motility group (HMG) DNA-binding domain. They are involved in the regulation of embryonic development when it forms complexes with Oc Show more
Description: A polyclonal antibody for SOX2 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human SOX2. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This SOX2 antibody is conjugated to Dylight 488.

Antibody for Human SOX2
SPC-1287D-DY594	Stressmarq	0.1ml	EUR 397.00
The SOX (SRY-box containing gene) gene family encodes a group of transcription factors defined by the conserved high motility group (HMG) DNA-binding domain. They are involved in the regulation of embryonic development when it forms complexes with Oc Show more
Description: A polyclonal antibody for SOX2 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human SOX2. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This SOX2 antibody is conjugated to Dylight 594.

Antibody for Human SOX2
SPC-1287D-DY633	Stressmarq	0.1ml	EUR 387.00
The SOX (SRY-box containing gene) gene family encodes a group of transcription factors defined by the conserved high motility group (HMG) DNA-binding domain. They are involved in the regulation of embryonic development when it forms complexes with Oc Show more
Description: A polyclonal antibody for SOX2 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human SOX2. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This SOX2 antibody is conjugated to Dylight 633.

Antibody for Human SOX2
SPC-1287D-FITC	Stressmarq	0.1ml	EUR 353.00
The SOX (SRY-box containing gene) gene family encodes a group of transcription factors defined by the conserved high motility group (HMG) DNA-binding domain. They are involved in the regulation of embryonic development when it forms complexes with Oc Show more
Description: A polyclonal antibody for SOX2 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human SOX2. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This SOX2 antibody is conjugated to FITC.

Antibody for Human SOX2
SPC-1287D-HRP	Stressmarq	0.1ml	EUR 349.00
The SOX (SRY-box containing gene) gene family encodes a group of transcription factors defined by the conserved high motility group (HMG) DNA-binding domain. They are involved in the regulation of embryonic development when it forms complexes with Oc Show more
Description: A polyclonal antibody for SOX2 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human SOX2. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This SOX2 antibody is conjugated to HRP.

Antibody for Human SOX2
SPC-1287D-P594	Stressmarq	0.1ml	EUR 367.00
The SOX (SRY-box containing gene) gene family encodes a group of transcription factors defined by the conserved high motility group (HMG) DNA-binding domain. They are involved in the regulation of embryonic development when it forms complexes with Oc Show more
Description: A polyclonal antibody for SOX2 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human SOX2. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This SOX2 antibody is conjugated to PE/ATTO 594.

Antibody for Human SOX2
SPC-1287D-PCP	Stressmarq	0.1ml	EUR 359.00
The SOX (SRY-box containing gene) gene family encodes a group of transcription factors defined by the conserved high motility group (HMG) DNA-binding domain. They are involved in the regulation of embryonic development when it forms complexes with Oc Show more
Description: A polyclonal antibody for SOX2 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human SOX2. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This SOX2 antibody is conjugated to PerCP.

Antibody for Human SOX2
SPC-1287D-RPE	Stressmarq	0.1ml	EUR 358.00
The SOX (SRY-box containing gene) gene family encodes a group of transcription factors defined by the conserved high motility group (HMG) DNA-binding domain. They are involved in the regulation of embryonic development when it forms complexes with Oc Show more
Description: A polyclonal antibody for SOX2 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human SOX2. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This SOX2 antibody is conjugated to RPE .

Antibody for Human SOX2
SPC-1287D-STR	Stressmarq	0.1ml	EUR 359.00
The SOX (SRY-box containing gene) gene family encodes a group of transcription factors defined by the conserved high motility group (HMG) DNA-binding domain. They are involved in the regulation of embryonic development when it forms complexes with Oc Show more
Description: A polyclonal antibody for SOX2 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human SOX2. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This SOX2 antibody is conjugated to Streptavidin.

Anti-SOX2 Antibody BIOTIN
STJ503094	St John's Laboratory	100 µg	EUR 586.00

Anti-SOX2 Antibody FITC
STJ503095	St John's Laboratory	100 µg	EUR 586.00

Anti-SOX2 Antibody BIOTIN
STJ503096	St John's Laboratory	100 µg	EUR 586.00

Anti-SOX2 Antibody FITC
STJ503097	St John's Laboratory	100 µg	EUR 586.00

Human SOX2 Antibody (Biotin Conjugate)
32612-05121	AssayPro	150 ug	EUR 369.00

sox2 (Phospho-Ser249/250) Antibody
13291-100ul	SAB	100ul	EUR 252.00