
Identification of diagnostic and prognostic biomarkers, and candidate focused brokers for hepatitis B virus-associated early stage hepatocellular carcinoma based mostly on RNA-sequencing information


  • Major liver most cancers is a quickly progressing neoplasm with excessive morbidity and mortality charges. The current research aimed to determine potential diagnostic and prognostic biomarkers, and candidate focused brokers for hepatitis B virus (HBV)-associated early stage hepatocellular carcinoma (HCC). The gene expression profiles had been extracted from the Gene Expression Omnibus database.


  • Differentially expressed genes (DEGs), hub genes and the enrichment of signaling pathways had been filtered out through a high-throughput sequencing technique. The affiliation between hub genes and the results of the irregular expression of hub genes on the speed of genetic variation, total survival (OS), relapse-free survival (RFS), progression-free survival (PFS) and disease-free survival (DSS) of sufferers with HCC, in addition to pathological stage and grade, had been analyzed utilizing completely different databases. A complete of 1,582 DEGs had been recognized.



  • Gene Ontology evaluation revealed that the DEGs had been primarily concerned within the ‘oxidation-reduction course of’, ‘steroid metabolic course of’, ‘metabolic course of’ and ‘fatty acid beta-oxidation’. Enrichment evaluation of Kyoto Encyclopedia of Genes and Genomes pathways revealed that the DEGs had been primarily related to ‘metabolic pathways’, ‘PPAR signaling pathway’, ‘fatty acid degradation’ and the ‘cell cycle’.


  • A complete of Eight hub genes had been extracted. Moreover, the irregular expression ranges of hub genes had been intently related to the OS, RFS, PFS and DSS of sufferers, the pathological stage and the grade. Moreover, irregular expression ranges of the Eight hub genes had been present in >30% of all samples.



  • A number of small molecular compounds which will reverse the altered DEGs had been recognized based mostly on Connectivity Map evaluation, together with phenoxybenzamine, GW-8510, resveratrol, 0175029-0000 and daunorubicin. In conclusion, the dysfunction of fats metabolic pathways, the cell cycle, oxidation-reduction processes and viral carcinogenesis might serve vital roles within the incidence of HBV-associated early stage HCC. The recognized Eight hub genes might act as strong biomarkers for prognosis and prognosis. Some small molecular compounds could also be promising focused brokers in opposition to HBV-associated early stage HCC.




PEG3 Antibody

ABF9152 100 ug
EUR 438

PEG3 antibody

70R-32122 100 ug
EUR 327
Description: Rabbit polyclonal PEG3 antibody

PEG3 Antibody

34056-100ul 100ul
EUR 252

PEG3 Antibody

34056-50ul 50ul
EUR 187

PEG3 Antibody

43302-100ul 100ul
EUR 252

PEG3 Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against PEG3. Recognizes PEG3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

PEG3 Antibody

CSB-PA022042-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against PEG3. Recognizes PEG3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

PEG3 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PEG3. Recognizes PEG3 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

PEG3 Conjugated Antibody

C34056 100ul
EUR 397

PEG3 Polyclonal Antibody

ES6567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PEG3 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

PEG3 Polyclonal Antibody

ES6567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PEG3 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

PEG3 Polyclonal Antibody

ABP55568-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human PEG3 at AA range: 1010-1090
  • Applications tips:
Description: A polyclonal antibody for detection of PEG3 from Human. This PEG3 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PEG3 at AA range: 1010-1090

PEG3 Polyclonal Antibody

ABP55568-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human PEG3 at AA range: 1010-1090
  • Applications tips:
Description: A polyclonal antibody for detection of PEG3 from Human. This PEG3 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PEG3 at AA range: 1010-1090

PEG3 Polyclonal Antibody

ABP55568-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human PEG3 at AA range: 1010-1090
  • Applications tips:
Description: A polyclonal antibody for detection of PEG3 from Human. This PEG3 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PEG3 at AA range: 1010-1090

Anti-PEG3 Antibody

A02541 100ul
EUR 397
Description: Rabbit Polyclonal PEG3 Antibody. Validated in WB and tested in Human.

Anti-PEG3 antibody

STJ95024 200 µl
EUR 197
Description: Rabbit polyclonal to PEG3.

Anti-PEG3 antibody

STJ114545 100 µl
EUR 277
Description: In human, ZIM2 and PEG3 are treated as two distinct genes though they share multiple 5' exons and a common promoter and both genes are paternally expressed (PMID:15203203). Alternative splicing events connect their shared 5' exons either with the remaining 4 exons unique to ZIM2, or with the remaining 2 exons unique to PEG3. In contrast, in other mammals ZIM2 does not undergo imprinting and, in mouse, cow, and likely other mammals as well, the ZIM2 and PEG3 genes do not share exons. Human PEG3 protein belongs to the Kruppel C2H2-type zinc finger protein family. PEG3 may play a role in cell proliferation and p53-mediated apoptosis. PEG3 has also shown tumor suppressor activity and tumorigenesis in glioma and ovarian cells. Alternative splicing of this PEG3 gene results in multiple transcript variants encoding distinct isoforms.


HY-W007545 100mg
EUR 108


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PEG3 Blocking Peptide

AF9152-BP 1mg
EUR 195


ADC-L-121 unit Ask for price


HY-111377 10mg
EUR 211


HY-42637 100mg
EUR 153


HY-128767 5mg
EUR 113


H-7924.0500 0.5mg
EUR 383
Description: Sum Formula: C50H75N13O24


H-7924.1000 1.0mg
EUR 618
Description: Sum Formula: C50H75N13O24


HY-W017772 100mg
EUR 142


  • EUR 648.00
  • EUR 1233.00
  • 1 g
  • 5 g
  • Shipped within 1-2 weeks.


  • EUR 217.00
  • EUR 272.00
  • 1 g
  • 25 g
  • Shipped within 1-2 weeks.


  • EUR 676.00
  • EUR 843.00
  • 1 g
  • 5 g
  • Shipped within 1-2 weeks.


  • EUR 272.00
  • EUR 467.00
  • 1 g
  • 5 g
  • Shipped within 1-2 weeks.


  • EUR 370.00
  • EUR 829.00
  • 1 g
  • 5 g
  • Shipped within 1-2 weeks.


  • EUR 537.00
  • EUR 829.00
  • 1 g
  • 5 g
  • Shipped within 1-2 weeks.


  • EUR 244.00
  • EUR 439.00
  • 1 g
  • 5 g
  • Shipped within 1-2 weeks.


abx186382-1g 1 g
EUR 787
  • Shipped within 1-2 weeks.


abx186609-250mg 250 mg
EUR 439
  • Shipped within 1-2 weeks.


  • EUR 300.00
  • EUR 606.00
  • 1 g
  • 5 g
  • Shipped within 1-2 weeks.


  • EUR 537.00
  • EUR 1595.00
  • 1 g
  • 5 g
  • Shipped within 1-2 weeks.


  • EUR 370.00
  • EUR 746.00
  • 0.5 g
  • 1 g
  • Shipped within 1-2 weeks.


  • EUR 509.00
  • EUR 690.00
  • 0.5 g
  • 1 g
  • Shipped within 1-2 weeks.

PEG3 Rabbit pAb

A12671-100ul 100 ul
EUR 308

PEG3 Rabbit pAb

A12671-200ul 200 ul
EUR 459

PEG3 Rabbit pAb

A12671-20ul 20 ul
EUR 183

PEG3 Rabbit pAb

A12671-50ul 50 ul
EUR 223

Paternally Expressed 3 (PEG3) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Paternally Expressed 3 (PEG3) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Paternally Expressed 3 (PEG3) Antibody

abx331093-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Bis-PEG3-NHS Ester

ADC-L-120 unit Ask for price


HY-128801 100mg
EUR 131


  • EUR 495.00
  • EUR 4114.00
  • EUR 1274.00
  • 1 g
  • 25 g
  • 5 g
  • Shipped within 1-2 weeks.


  • EUR 551.00
  • EUR 1219.00
  • 1 g
  • 5 g
  • Shipped within 1-2 weeks.

Human PEG3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PEG3-tetrazine, 1 g

1978-1g 1 g
EUR 661

PEG3-tetrazine, 250 mg

1978-250mg 250 mg
EUR 305

Mouse PEG3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Biotin PEG3 azide, 10 mg

C3730 10 mg
EUR 60

Biotin PEG3 azide, 50 mg

E3730 50 mg
EUR 130


HY-100874 5mg
EUR 1221


HY-42776 100mg
EUR 108

N3-PEG3-C2-NHS ester

HY-126528 500mg
EUR 3264

Pomalidomide-PEG3-C2-NH2 (TFA)

HY-128716A 2g
EUR 5675

NHPI-PEG3-C2-Pfp ester

HY-130092 100mg
EUR 843

NHPI-PEG3-C2-NHS ester

HY-130093 100mg
EUR 843

Biotin PEG3 azide, 100 mg

F3730 100 mg
EUR 156

Alkyne-PEG3-OH, 1 g

418-1g 1 g
EUR 93

Alkyne-PEG3-OH, 5 g

418-5g 5 g
EUR 230

PEG3 dicarboxylic acid, 10 g

1715-10g 10 g
EUR 910

PEG3 dicarboxylic acid, 1 g

1715-1g 1 g
EUR 353

PEG3 dicarboxylic acid, 5 g

1715-5g 5 g
EUR 613

Alkyne-PEG3-COOH, 1 g

1743-1g 1 g
EUR 349

Alkyne-PEG3-COOH, 5 g

1743-5g 5 g
EUR 661

Azide-PEG3-Amine, 1 g

218-1g 1 g
EUR 93

Azide-PEG3-Amine, 5 g

218-5g 5 g
EUR 230

Azide-PEG3-Azide, 1 g

207-1g 1 g
EUR 101

Azide-PEG3-Azide, 5 g

207-5g 5 g
EUR 320

Biotin PEG3 azide, 25 mg

D3730 25 mg
EUR 97

PEG3 ORF Vector (Human) (pORF)

ORF027601 1.0 ug DNA
EUR 659

Peg3 ORF Vector (Mouse) (pORF)

ORF053769 1.0 ug DNA
EUR 1572


HY-103598 2g
EUR 5675


HY-103602A 1g
EUR 3896


HY-107440 2g
EUR 5675


HY-130098 100mg
EUR 578


HY-130100 100mg
EUR 843

TMP-PEG3-amine, trifluoroacetic acid salt

91056 1MG
EUR 195
Description: Minimum order quantity: 1 unit of 1MG

PEG3 sgRNA CRISPR Lentivector set (Human)

K1626501 3 x 1.0 ug
EUR 339

Peg3 sgRNA CRISPR Lentivector set (Mouse)

K4341801 3 x 1.0 ug
EUR 339

PEG3-AS1 ORF Vector (Human) (pORF)

ORF027602 1.0 ug DNA Ask for price

(S,R,S)-AHPC-PEG3-NH2 (hydrochloride)

HY-103602 25mg
EUR 234

Thalidomide-O-amido-PEG3-C2-NH2 (TFA)

HY-103611 2g
EUR 5675

Ald-Ph-amido-PEG3-C2-Pfp ester

HY-130102 100mg
EUR 843

PEG3 sgRNA CRISPR Lentivector (Human) (Target 1)

K1626502 1.0 ug DNA
EUR 154

PEG3 sgRNA CRISPR Lentivector (Human) (Target 2)

K1626503 1.0 ug DNA
EUR 154

PEG3 sgRNA CRISPR Lentivector (Human) (Target 3)

K1626504 1.0 ug DNA
EUR 154

Peg3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4341802 1.0 ug DNA
EUR 154

Peg3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4341803 1.0 ug DNA
EUR 154

Peg3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4341804 1.0 ug DNA
EUR 154

PEG3 Protein Vector (Human) (pPB-C-His)

PV110402 500 ng
EUR 2280

PEG3 Protein Vector (Human) (pPB-N-His)

PV110403 500 ng
EUR 2280

PEG3 Protein Vector (Human) (pPM-C-HA)

PV110404 500 ng
EUR 2280

PEG3 Protein Vector (Human) (pPM-C-His)

PV110405 500 ng
EUR 2280

PEG3 Protein Vector (Mouse) (pPB-C-His)

PV215074 500 ng
EUR 2646

PEG3 Protein Vector (Mouse) (pPB-N-His)

PV215075 500 ng
EUR 2646

PEG3 Protein Vector (Mouse) (pPM-C-HA)

PV215076 500 ng
EUR 2646

PEG3 Protein Vector (Mouse) (pPM-C-His)

PV215077 500 ng
EUR 2646

Peg3 3'UTR GFP Stable Cell Line

TU166185 1.0 ml Ask for price

PEG3 3'UTR Luciferase Stable Cell Line

TU017722 1.0 ml
EUR 2333

Peg3 3'UTR Luciferase Stable Cell Line

TU116185 1.0 ml Ask for price

PEG3 3'UTR GFP Stable Cell Line

TU067722 1.0 ml
EUR 2333

Anti-ERBB2 (trastuzumab)-Amino-PEG3-Propionyl-MMAE ADC

ADC-W-629 1mg Ask for price
Description: This ADC product is comprised of an engineerd anti-ERBB2 antibody (trastuzumab with LLQGG tag at Fc) conjugated via a Amino-PEG3-Propionyl linker to MMAE


HY-103605 1g
EUR 3896

Mouse Paternally- expressed gene 3 protein, Peg3 ELISA KIT

ELI-20913m 96 Tests
EUR 865

Human Paternally- expressed gene 3 protein, PEG3 ELISA KIT

ELI-22084h 96 Tests
EUR 824

Bovine Paternally- expressed gene 3 protein, PEG3 ELISA KIT

ELI-45910b 96 Tests
EUR 928

PEG3-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV772727 1.0 ug DNA Ask for price

PEG3-AS1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV772731 1.0 ug DNA Ask for price

PEG3-AS1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV772732 1.0 ug DNA Ask for price

PEG3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1626505 3 x 1.0 ug
EUR 376

Peg3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4341805 3 x 1.0 ug
EUR 376

PEG3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1626506 1.0 ug DNA
EUR 167

PEG3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1626507 1.0 ug DNA
EUR 167

PEG3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1626508 1.0 ug DNA
EUR 167

Peg3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4341806 1.0 ug DNA
EUR 167

Peg3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4341807 1.0 ug DNA
EUR 167

Peg3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4341808 1.0 ug DNA
EUR 167

PEG3-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV772729 1.0 ug DNA Ask for price

PEG3-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV772730 1.0 ug DNA Ask for price

H2B Antibody Antibody

AF4659 200ul
EUR 376
Description: H2B Antibody Antibody detects endogenous levels of H2B.

CD11b Antibody Antibody

ABD2911 100 ug
EUR 438

anti- Antibody^Polyclonal antibody control antibody

LSMab09882 100 ug
EUR 438

Ly1 Antibody Reactive (LYAR) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Anti-Glycolipid Antibody (AGA) Antibody

abx036399-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

abx033330-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

abx033330-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Anti-Glycolipid Antibody (AGA) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

abx234901-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Anti-Glycolipid Antibody (AGA) Antibody

abx230204-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Anti-Anti-SEPT2 Antibody antibody

STJ28365 100 µl
EUR 277

Anti-Anti-SEPT7 Antibody antibody

STJ28963 100 µl
EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-SEPT6 antibody antibody

STJ11100949 100 µl
EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis. One version of pediatric acute myeloid leukemia is the result of a reciprocal translocation between chromosomes 11 and X, with the breakpoint associated with the genes encoding the mixed-lineage leukemia and septin 2 proteins. This gene encodes four transcript variants encoding three distinct isoforms. An additional transcript variant has been identified, but its biological validity has not been determined.

Anti-Anti-SEPT2 Antibody antibody

STJ25475 100 µl
EUR 277

Anti-Anti-SEPT5 Antibody antibody

STJ25477 100 µl
EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-SEPT8 Antibody antibody

STJ25479 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT9 Antibody antibody

STJ111369 100 µl
EUR 277
Description: This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described.

Anti-Anti-SEPT11 Antibody antibody

STJ111530 100 µl
EUR 277

Anti-Anti-SEPT4 Antibody antibody

STJ112276 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer.

Anti-Anti-MARCH9 Antibody antibody

STJ112609 100 µl
EUR 277

Anti-Anti-SEPT11 Antibody antibody

STJ113941 100 µl
EUR 277

Anti-Anti-SEPT11 Antibody antibody

STJ114081 100 µl
EUR 277

Anti-Anti-SEPT5 Antibody antibody

STJ114819 100 µl
EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-MARCH8 Antibody antibody

STJ114828 100 µl
EUR 277

Anti-Anti-MARCH6 Antibody antibody

STJ118549 100 µl
EUR 277

Anti-Anti-MARCH6 Antibody antibody

STJ118550 100 µl
EUR 277

Anti-Anti-MARCH7 Antibody antibody

STJ118752 100 µl
EUR 277

Anti-Anti-SEPT3 Antibody antibody

STJ118990 100 µl
EUR 277

Anti-Anti-SEPT1 antibody antibody

STJ119580 100 µl
EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis and the maintenance of cellular morphology. This gene encodes a protein that can form homo- and heterooligomeric filaments, and may contribute to the formation of neurofibrillary tangles in Alzheimer's disease. Alternatively spliced transcript variants have been found but the full-length nature of these variants has not been determined. [provided by RefSeq, Dec 2012]

Anti-Anti-SEPT7 Antibody antibody

STJ116214 100 µl
EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-SEPT8 Antibody antibody

STJ117206 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT12 Antibody antibody

STJ117759 100 µl
EUR 277
Description: This gene encodes a guanine-nucleotide binding protein and member of the septin family of cytoskeletal GTPases. Septins play important roles in cytokinesis, exocytosis, embryonic development, and membrane dynamics. Multiple transcript variants encoding different isoforms have been found for this gene.

Monoclonal NGF/proNGF Neutralizing Antibody Antibody

AMM06679G 0.05mg
EUR 528
Description: A Monoclonal antibody against Human NGF/proNGF Neutralizing. The antibodies are raised in Mouse. This antibody is applicable in E

Ly1 Antibody Reactive Homolog (LYAR) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Ly1 Antibody Reactive Homolog (LYAR) Antibody

  • EUR 467.00
  • EUR 133.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Ly1 Antibody Reactive Homolog (LYAR) Antibody

  • EUR 481.00
  • EUR 133.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hepatitis C Virus Antibody (HCV) Antibody

abx023924-1mg 1 mg
EUR 1205
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.



SUMO4 small interfering RNA attenuates invasion and migration through the JAK2/STAT3 pathway in non-small cell lung most cancers cells


  • Small ubiquitin-like modifier 4 (SUMO4) is the most recent member of the sumoylation household, which boosts the steadiness of protein, regulates the distribution and localization of the protein, and impacts the transcription exercise of the protein. Nevertheless, the function of SUMO4 in non-small cell lung most cancers (NSCLC) has not but been reported.
  • The current research first demonstrated that SUMO4 was upregulated in quite a lot of tissues from sufferers with NSCLC. Immunohistochemistry was carried out to display the expression degree of SUMO4 in lung most cancers tumor tissues. Following the transfection, The EMT standing and signaling pathway activation regulated by SUMO4-siRNA was assessed by western blotting.
  • The Transwell and wound therapeutic assays had been carried out to research the regulatory impact of SUMO4-siRNA on cell migration and invasion. Cell Counting Equipment-Eight assay was carried out to research whether or not SUMO4-siRNA affected the chemosensitivity of the NSCLC cells to cisplatin. Statistical evaluation of immunohistochemical outcomes from the tissues confirmed that the overexpression of SUMO4 was considerably related to intercourse, tumor kind, historical past of smoking, T stage and poor prognosis.
  • It was additionally recognized that SUMO4 small interfering RNA attenuated invasion and migration in NSCLC cell traces, as effectively chemosensitivity to cisplatin through the inhibition of the JAK2/STAT3 pathway. In conclusion, SUMO4 might play an essential function within the poor prognosis of sufferers with NSCLC. The current research signifies that SUMO4 could also be a possible therapeutic goal for NSCLC.


Low-cost RNA extraction technique for extremely scalable transcriptome research


RNA extraction has been improved by integration of quite a lot of supplies within the protocol, akin to phenol, guanidine thiocyanate, and silica, in line with the case-specific calls for. Nevertheless, few strategies have been designed for high-throughput RNA preparation for large-scale transcriptome research. On this research, we established a high-throughput guanidinium thiocyanate and isopropyl alcohol based mostly RNA extraction technique (HighGI).

HighGI relies on easy and phenol-free do-it-yourself buffers and the associated fee is considerably decrease than a column-based business package. We demonstrated that the standard and amount of RNA extracted with HighGI had been corresponding to these extracted with a typical phenol/chloroform-based technique and a column-based business package. HighGI retained small RNAs lower than 200 bp, that are misplaced with a business column-based package.

We additionally demonstrated that HighGI is quickly relevant to semi-automated RNA extraction. HighGI permits high-throughput RNA extraction for large-scale RNA preparation with excessive yield and high quality.

Anti-CGA antibody

STJ23110 100 µl
EUR 277
Description: The four human glycoprotein hormones chorionic gonadotropin (CG), luteinizing hormone (LH), follicle stimulating hormone (FSH), and thyroid stimulating hormone (TSH) are dimers consisting of alpha and beta subunits that are associated noncovalently. The alpha subunits of these hormones are identical, however, their beta chains are unique and confer biological specificity. The protein encoded by this gene is the alpha subunit and belongs to the glycoprotein hormones alpha chain family. Two transcript variants encoding different isoforms have been found for this gene.

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349

Human Chorionic Gonadotropin Alpha Polypeptide (CGa) ELISA Kit

DLR-CGa-Hu-48T 48T
EUR 498
  • Should the Human Chorionic Gonadotropin Alpha Polypeptide (CGa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Chorionic Gonadotropin Alpha Polypeptide (CGa) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Chorionic Gonadotropin Alpha Polypeptide (CGa) ELISA Kit

DLR-CGa-Hu-96T 96T
EUR 647
  • Should the Human Chorionic Gonadotropin Alpha Polypeptide (CGa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Chorionic Gonadotropin Alpha Polypeptide (CGa) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Chorionic Gonadotropin Alpha Polypeptide (CGa) ELISA Kit

RDR-CGa-Hu-48Tests 48 Tests
EUR 522

Human Chorionic Gonadotropin Alpha Polypeptide (CGa) ELISA Kit

RDR-CGa-Hu-96Tests 96 Tests
EUR 724

Human Chorionic Gonadotropin Alpha Polypeptide (CGa) ELISA Kit

RD-CGa-Hu-48Tests 48 Tests
EUR 500

Human Chorionic Gonadotropin Alpha Polypeptide (CGa) ELISA Kit

RD-CGa-Hu-96Tests 96 Tests
EUR 692

CGA Antibody

32250-100ul 100ul
EUR 252

CgA antibody

10R-2291 1 mL
EUR 584
Description: Mouse monoclonal CgA antibody

CGA Antibody

EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against CGA. Recognizes CGA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

CGA Antibody

CSB-PA005293KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against CGA. Recognizes CGA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

CGA Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CGA. Recognizes CGA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

CGA Antibody

DF6371 200ul
EUR 304
Description: CGA Antibody detects endogenous levels of total CGA.

CGA Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CGA. Recognizes CGA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

CGA Antibody

ABD6371 100 ug
EUR 438

CGA Conjugated Antibody

C32250 100ul
EUR 397

CgA/ Rat CgA ELISA Kit

ELA-E1212r 96 Tests
EUR 886

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNUM1060-50 50uL
EUR 395
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), 1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNUB1060-100 100uL
EUR 209
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), Concentration: 0.2mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNUB1060-500 500uL
EUR 458
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), Concentration: 0.2mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNC551060-100 100uL
EUR 199
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF555 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNC551060-500 500uL
EUR 544
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF555 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNC611060-100 100uL
EUR 199
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF660R conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNC611060-500 500uL
EUR 544
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF660R conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNC471060-100 100uL
EUR 199
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF647 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNC471060-500 500uL
EUR 544
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF647 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNC051060-100 100uL
EUR 199
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF405M conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNC051060-500 500uL
EUR 544
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF405M conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNC401060-100 100uL
EUR 199
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF640R conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNC401060-500 500uL
EUR 544
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF640R conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNC431060-100 100uL
EUR 199
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF543 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNC431060-500 500uL
EUR 544
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF543 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNC041060-100 100uL
EUR 199
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF405S conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNC041060-500 500uL
EUR 544
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF405S conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNC801060-100 100uL
EUR 199
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF680 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNC801060-500 500uL
EUR 544
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF680 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNCP1060-250 250uL
EUR 383
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), PerCP conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNCR1060-250 250uL
EUR 383
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), RPE conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNCA1060-250 250uL
EUR 383
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), APC conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNCAP1060-100 100uL
EUR 199
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNCAP1060-500 500uL
EUR 544
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNCB1060-100 100uL
EUR 199
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), Biotin conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNCB1060-500 500uL
EUR 544
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), Biotin conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNCH1060-100 100uL
EUR 199
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNCH1060-500 500uL
EUR 544
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNC881060-100 100uL
EUR 199
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF488A conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNC881060-500 500uL
EUR 544
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF488A conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNC941060-100 100uL
EUR 199
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF594 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNC941060-500 500uL
EUR 544
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF594 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNC681060-100 100uL
EUR 199
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF568 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNC681060-500 500uL
EUR 544
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF568 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNC701060-100 100uL
EUR 199
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF770 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNC701060-500 500uL
EUR 544
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF770 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNC811060-100 100uL
EUR 199
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF680R conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNC811060-500 500uL
EUR 544
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF680R conjugate, Concentration: 0.1mg/mL

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Polyclonal CGA / hCG Alpha Antibody

APG02559G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human CGA / hCG Alpha . This antibody is tested and proven to work in the following applications:

Monoclonal CGA Antibody, Clone: 2E6B3

APG02561G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human CGA. The antibodies are raised in Mouse and are from clone 2E6B3. This antibody is applicable in WB, E

Monoclonal CGA Antibody, Clone: EP3373

APG02562G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human CGA. The antibodies are raised in Rabbit and are from clone EP3373. This antibody is applicable in WB and IHC

Chromogranin A(CGA/414) Antibody

BNUB0414-100 100uL
EUR 209
Description: Primary antibody against Chromogranin A(CGA/414), Concentration: 0.2mg/mL

Chromogranin A(CGA/414) Antibody

BNUB0414-500 500uL
EUR 458
Description: Primary antibody against Chromogranin A(CGA/414), Concentration: 0.2mg/mL

Chromogranin A(CGA/414) Antibody

BNUM0414-50 50uL
EUR 395
Description: Primary antibody against Chromogranin A(CGA/414), 1mg/mL

Chromogranin A(CGA/414) Antibody

BNC040414-100 100uL
EUR 199
Description: Primary antibody against Chromogranin A(CGA/414), CF405S conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNC040414-500 500uL
EUR 544
Description: Primary antibody against Chromogranin A(CGA/414), CF405S conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNC610414-100 100uL
EUR 199
Description: Primary antibody against Chromogranin A(CGA/414), CF660R conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNC610414-500 500uL
EUR 544
Description: Primary antibody against Chromogranin A(CGA/414), CF660R conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNC470414-100 100uL
EUR 199
Description: Primary antibody against Chromogranin A(CGA/414), CF647 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNC470414-500 500uL
EUR 544
Description: Primary antibody against Chromogranin A(CGA/414), CF647 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNC550414-100 100uL
EUR 199
Description: Primary antibody against Chromogranin A(CGA/414), CF555 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNC550414-500 500uL
EUR 544
Description: Primary antibody against Chromogranin A(CGA/414), CF555 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNC050414-100 100uL
EUR 199
Description: Primary antibody against Chromogranin A(CGA/414), CF405M conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNC050414-500 500uL
EUR 544
Description: Primary antibody against Chromogranin A(CGA/414), CF405M conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNC400414-100 100uL
EUR 199
Description: Primary antibody against Chromogranin A(CGA/414), CF640R conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNC400414-500 500uL
EUR 544
Description: Primary antibody against Chromogranin A(CGA/414), CF640R conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNC430414-100 100uL
EUR 199
Description: Primary antibody against Chromogranin A(CGA/414), CF543 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNC430414-500 500uL
EUR 544
Description: Primary antibody against Chromogranin A(CGA/414), CF543 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNC800414-100 100uL
EUR 199
Description: Primary antibody against Chromogranin A(CGA/414), CF680 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNC800414-500 500uL
EUR 544
Description: Primary antibody against Chromogranin A(CGA/414), CF680 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNC810414-100 100uL
EUR 199
Description: Primary antibody against Chromogranin A(CGA/414), CF680R conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNC810414-500 500uL
EUR 544
Description: Primary antibody against Chromogranin A(CGA/414), CF680R conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNCP0414-250 250uL
EUR 383
Description: Primary antibody against Chromogranin A(CGA/414), PerCP conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNCR0414-250 250uL
EUR 383
Description: Primary antibody against Chromogranin A(CGA/414), RPE conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNCA0414-250 250uL
EUR 383
Description: Primary antibody against Chromogranin A(CGA/414), APC conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNCAP0414-100 100uL
EUR 199
Description: Primary antibody against Chromogranin A(CGA/414), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNCAP0414-500 500uL
EUR 544
Description: Primary antibody against Chromogranin A(CGA/414), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNCH0414-100 100uL
EUR 199
Description: Primary antibody against Chromogranin A(CGA/414), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNCH0414-500 500uL
EUR 544
Description: Primary antibody against Chromogranin A(CGA/414), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNC940414-100 100uL
EUR 199
Description: Primary antibody against Chromogranin A(CGA/414), CF594 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNC940414-500 500uL
EUR 544
Description: Primary antibody against Chromogranin A(CGA/414), CF594 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNC700414-100 100uL
EUR 199
Description: Primary antibody against Chromogranin A(CGA/414), CF770 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNC700414-500 500uL
EUR 544
Description: Primary antibody against Chromogranin A(CGA/414), CF770 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNCB0414-100 100uL
EUR 199
Description: Primary antibody against Chromogranin A(CGA/414), Biotin conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNCB0414-500 500uL
EUR 544
Description: Primary antibody against Chromogranin A(CGA/414), Biotin conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNC880414-100 100uL
EUR 199
Description: Primary antibody against Chromogranin A(CGA/414), CF488A conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNC880414-500 500uL
EUR 544
Description: Primary antibody against Chromogranin A(CGA/414), CF488A conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNC680414-100 100uL
EUR 199
Description: Primary antibody against Chromogranin A(CGA/414), CF568 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNC680414-500 500uL
EUR 544
Description: Primary antibody against Chromogranin A(CGA/414), CF568 conjugate, Concentration: 0.1mg/mL

CGA Rabbit pAb

A1239-100ul 100 ul
EUR 308

CGA Rabbit pAb

A1239-200ul 200 ul
EUR 459

CGA Rabbit pAb

A1239-20ul 20 ul
EUR 183

CGA Rabbit pAb

A1239-50ul 50 ul
EUR 223

CGA Blocking Peptide

DF6371-BP 1mg
EUR 195

CGA cloning plasmid

CSB-CL005293HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 351
  • Sequence: atggattactacagaaaatatgcagctatctttctggtcacattgtcggtgtttctgcatgttctccattccgctcctgatgtgcaggattgcccagaatgcacgctacaggaaaacccactcttctcccagccgggtgccccaatacttcagtgcatgggctgctgcttctctag
  • Show more
Description: A cloning plasmid for the CGA gene.

CGA cloning plasmid

CSB-CL005293HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 351
  • Sequence: atggattactacagaaaatatgcagctatctttctggtcacattgtcggtgtttctgcatgttctccattccgctcctgatgtgcaggattgcccagaatgcacgctacaggaaaacccattcttctcccagccgggtgccccaatacttcagtgcatgggctgctgcttctctag
  • Show more
Description: A cloning plasmid for the CGA gene.

Anti-Chromogranin A/ CHGA Antibody Clone CGA/414, Unconjugated-100ug

1113-MSM1-P1 100ug
EUR 428

Anti-Chromogranin A/ CHGA Antibody Clone CGA/413, Unconjugated-100ug

1113-MSM9-P1 100ug
EUR 428

Glycoprotein Hormones Alpha Chain (CGA) Antibody

abx215829-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Glycoprotein Hormones Alpha Chain (CGA) Antibody

abx224103-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

Glycoprotein Hormones Alpha Chain (CGA) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Glycoprotein Hormones Alpha Chain (CGA) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Chorionic Gonadotropin Alpha Polypeptide (CGa) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Chorionic Gonadotropin Alpha Polypeptide (CGa) Antibody

  • EUR 300.00
  • EUR 133.00
  • EUR 801.00
  • EUR 425.00
  • EUR 258.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Glycoprotein Hormones Alpha Chain (CGA) Antibody

abx117075-100ug 100 ug
EUR 467
  • Shipped within 5-10 working days.

Chorionic Gonadotropin Alpha Polypeptide (CGa) Antibody

  • EUR 328.00
  • EUR 815.00
  • EUR 425.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-12 working days.

Glycoprotein Hormones Alpha Chain (CGA) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Glycoprotein Hormones Alpha Chain (CGA) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.


ELA-E0441h 96 Tests
EUR 824


EF004143 96 Tests
EUR 689

Mouse CGA shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CGA shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CGA Recombinant Protein (Human)

RP006901 100 ug Ask for price

CGA Recombinant Protein (Human)

RP006904 100 ug Ask for price

CGA Recombinant Protein (Rat)

RP194735 100 ug Ask for price

CGA Recombinant Protein (Mouse)

RP123761 100 ug Ask for price


STJ150209 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of HCG in human serum, plasma and other biological fluids

Anti-Chromogranin A / CHGA Antibody (CGA/413 + CHGA/777 + CHGA/798)

EUR 479

Chorionic Gonadotropin Alpha Polypeptide (CGa) Antibody (Biotin)

  • EUR 439.00
  • EUR 244.00
  • EUR 1261.00
  • EUR 606.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Chorionic Gonadotropin Alpha Polypeptide (CGa) Antibody (Biotin)

  • EUR 467.00
  • EUR 244.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Chorionic Gonadotropin Alpha Polypeptide (CGa) Antibody (FITC)

  • EUR 495.00
  • EUR 258.00
  • EUR 1455.00
  • EUR 676.00
  • EUR 398.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Anti-Chromogranin A/ CHGA Antibody Clone LK2H10 + PHE5 + CGA/414, Unconjugated-100ug

1113-MSM5-P1 100ug
EUR 428

Human Chromogranin,CgA ELISA Kit

201-12-1731 96 tests
EUR 440
  • This Chromogranin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Chromogranin,CgA ELISA Kit

CN-04332H1 96T
EUR 486

Human Chromogranin,CgA ELISA Kit

CN-04332H2 48T
EUR 336

Human Chromogranin, CgA ELISA Kit

CSB-E09153h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Chromogranin, CgA in samples from serum, plasma, cell culture supernates, urine, cerebrospinalfluid (CSF). A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Chromogranin, CgA ELISA Kit

  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Chromogranin, CgA in samples from serum, plasma, cell culture supernates, urine, cerebrospinalfluid(CSF). Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat Chromogranin(CgA)ELISA Kit

GA-E0565RT-48T 48T
EUR 317

Rat Chromogranin(CgA)ELISA Kit

GA-E0565RT-96T 96T
EUR 496

Chromogranin A (CgA) ELISA Kit

EUR 914

Cga ORF Vector (Rat) (pORF)

ORF064913 1.0 ug DNA
EUR 506

CGA ORF Vector (Human) (pORF)

ORF002301 1.0 ug DNA
EUR 95

CGA ORF Vector (Human) (pORF)

ORF002302 1.0 ug DNA
EUR 95

Cga ORF Vector (Mouse) (pORF)

ORF041255 1.0 ug DNA
EUR 506

Rat Chromogranin(CgA)ELISA Kit

QY-E11087 96T
EUR 361

pGL3-Basic-CGA promoter Plasmid

PVTB80059-2a 2 ug
EUR 356

Mouse Chromogranin(CgA)ELISA Kit

QY-E20322 96T
EUR 361

CGA ELISA Kit (Human) (OKAN04321)

OKAN04321 96 Wells
EUR 792
Description: Description of target: The four human glycoprotein hormones chorionic gonadotropin (CG), luteinizing hormone (LH), follicle stimulating hormone (FSH), and thyroid stimulating hormone (TSH) are dimers consisting of alpha and beta subunits that are associated noncovalently. The alpha subunits of these hormones are identical, however, their beta chains are unique and confer biological specificity. The protein encoded by this gene is the alpha subunit and belongs to the glycoprotein hormones alpha chain family. Two transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.34 mIU/mL

CGA ELISA Kit (Goat) (OKCA00590)

OKCA00590 96 Wells
EUR 728
Description: Description of target: ;Species reactivity: Goat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.25 uIU/mL

CGA ELISA Kit (Human) (OKCD06874)

OKCD06874 96 Wells
EUR 635
Description: Description of target: The four human glycoprotein hormones chorionic gonadotropin (CG), luteinizing hormone (LH), follicle stimulating hormone (FSH), and thyroid stimulating hormone (TSH) are dimers consisting of alpha and beta subunits that are associated noncovalently. The alpha subunits of these hormones are identical, however, their beta chains are unique and confer biological specificity. The protein encoded by this gene is the alpha subunit and belongs to the glycoprotein hormones alpha chain family. Two transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.34mIU/mL

CGA ELISA Kit (Mouse) (OKCD06875)

OKCD06875 96 Wells
EUR 779
Description: Description of target: The four human glycoprotein hormones chorionic gonadotropin (CG), luteinizing hormone (LH), follicle stimulating hormone (FSH), and thyroid stimulating hormone (TSH) are dimers consisting of alpha and beta subunits that are associated noncovalently. The alpha subunits of these hormones are identical, however, their beta chains are unique and confer biological specificity. The protein encoded by this gene is the alpha subunit and belongs to the glycoprotein hormones alpha chain family. Two transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.82ng/mL

CGA ELISA Kit (Human) (OKCD07526)

OKCD07526 96 Wells
EUR 936
Description: Description of target: The four human glycoprotein hormones chorionic gonadotropin (CG), luteinizing hormone (LH), follicle stimulating hormone (FSH), and thyroid stimulating hormone (TSH) are dimers consisting of alpha and beta subunits that are associated noncovalently. The alpha subunits of these hormones are identical, however, their beta chains are unique and confer biological specificity. The protein encoded by this gene is the alpha subunit and belongs to the glycoprotein hormones alpha chain family. Two transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.057ng/mL

CGA ELISA Kit (Pig) (OKEH07390)

OKEH07390 96 Wells
EUR 648
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.2ng/mL

CGA ELISA Kit (Mouse) (OKEH02958)

OKEH02958 96 Wells
EUR 414
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 1.56uIU/mL

CGA ELISA Kit (Fish) (OKEH03759)

OKEH03759 96 Wells
EUR 479
Description: Description of target: ;Species reactivity: Fish;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.32mIU/mL

CGA ELISA Kit (Bovine) (OKEH03760)

OKEH03760 96 Wells
EUR 479
Description: Description of target: ;Species reactivity: Bovine;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.22mIU/mL

CGA ELISA Kit (Dog) (OKEH03761)

OKEH03761 96 Wells
EUR 479
Description: Description of target: ;Species reactivity: Dog;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.2mIU/mL

Chorionic Gonadotropin Alpha Polypeptide (CGa) Monoclonal Antibody (Human)

  • EUR 247.00
  • EUR 2516.00
  • EUR 626.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Mouse monoclonal antibody against Human Chorionic Gonadotropin Alpha Polypeptide (CGa)

Chorionic Gonadotropin Alpha Polypeptide (CGa) Polyclonal Antibody (Human)

  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Leu25~Ser120
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chorionic Gonadotropin Alpha Polypeptide (CGa)

Chorionic Gonadotropin Alpha Polypeptide (CGa) Polyclonal Antibody (Mouse)

  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CGa (Leu25~Ser120)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Chorionic Gonadotropin Alpha Polypeptide (CGa)

Human CGA(Chromogranin A) ELISA Kit

EH0486 96T
EUR 524.1
  • Detection range: 0.781-50 ng/ml
  • Uniprot ID: P10645
  • Alias: CGA(Chromogranin A)
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469 ng/ml

Human Chromogranin A(CgA)ELISA Kit

GA-E1747HM-48T 48T
EUR 289