Identification of diagnostic and prognostic biomarkers, and candidate focused brokers for hepatitis B virus-associated early stage hepatocellular carcinoma based mostly on RNA-sequencing information
- Major liver most cancers is a quickly progressing neoplasm with excessive morbidity and mortality charges. The current research aimed to determine potential diagnostic and prognostic biomarkers, and candidate focused brokers for hepatitis B virus (HBV)-associated early stage hepatocellular carcinoma (HCC). The gene expression profiles had been extracted from the Gene Expression Omnibus database.
- Differentially expressed genes (DEGs), hub genes and the enrichment of signaling pathways had been filtered out through a high-throughput sequencing technique. The affiliation between hub genes and the results of the irregular expression of hub genes on the speed of genetic variation, total survival (OS), relapse-free survival (RFS), progression-free survival (PFS) and disease-free survival (DSS) of sufferers with HCC, in addition to pathological stage and grade, had been analyzed utilizing completely different databases. A complete of 1,582 DEGs had been recognized.
- Gene Ontology evaluation revealed that the DEGs had been primarily concerned within the ‘oxidation-reduction course of’, ‘steroid metabolic course of’, ‘metabolic course of’ and ‘fatty acid beta-oxidation’. Enrichment evaluation of Kyoto Encyclopedia of Genes and Genomes pathways revealed that the DEGs had been primarily related to ‘metabolic pathways’, ‘PPAR signaling pathway’, ‘fatty acid degradation’ and the ‘cell cycle’.
- A complete of Eight hub genes had been extracted. Moreover, the irregular expression ranges of hub genes had been intently related to the OS, RFS, PFS and DSS of sufferers, the pathological stage and the grade. Moreover, irregular expression ranges of the Eight hub genes had been present in >30% of all samples.
- A number of small molecular compounds which will reverse the altered DEGs had been recognized based mostly on Connectivity Map evaluation, together with phenoxybenzamine, GW-8510, resveratrol, 0175029-0000 and daunorubicin. In conclusion, the dysfunction of fats metabolic pathways, the cell cycle, oxidation-reduction processes and viral carcinogenesis might serve vital roles within the incidence of HBV-associated early stage HCC. The recognized Eight hub genes might act as strong biomarkers for prognosis and prognosis. Some small molecular compounds could also be promising focused brokers in opposition to HBV-associated early stage HCC.

influenza-x
PEG3 Antibody |
34056-100ul |
SAB |
100ul |
EUR 252 |
PEG3 Antibody |
34056-50ul |
SAB |
50ul |
EUR 187 |
PEG3 Antibody |
43302-100ul |
SAB |
100ul |
EUR 252 |
PEG3 Antibody |
1-CSB-PA030033 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against PEG3. Recognizes PEG3 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000 |
PEG3 Antibody |
CSB-PA022042- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against PEG3. Recognizes PEG3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
PEG3 Antibody |
CSB-PA022042-100ul |
Cusabio |
100ul |
EUR 316 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against PEG3. Recognizes PEG3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
PEG3 Antibody |
AF9152 |
Affbiotech |
200ul |
EUR 304 |
Description: PEG3 Antibody detects endogenous levels of total PEG3. |
Anti-PEG3 Antibody |
A02541 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal PEG3 Antibody. Validated in WB and tested in Human. |
PEG3 Conjugated Antibody |
C34056 |
SAB |
100ul |
EUR 397 |
PEG3 Polyclonal Antibody |
ABP55568-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from the Internal region of human PEG3 at AA range: 1010-1090
- Applications tips:
|
Description: A polyclonal antibody for detection of PEG3 from Human. This PEG3 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PEG3 at AA range: 1010-1090 |
PEG3 Polyclonal Antibody |
ABP55568-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the Internal region of human PEG3 at AA range: 1010-1090
- Applications tips:
|
Description: A polyclonal antibody for detection of PEG3 from Human. This PEG3 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PEG3 at AA range: 1010-1090 |
PEG3 Polyclonal Antibody |
ABP55568-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the Internal region of human PEG3 at AA range: 1010-1090
- Applications tips:
|
Description: A polyclonal antibody for detection of PEG3 from Human. This PEG3 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PEG3 at AA range: 1010-1090 |
PEG3 Polyclonal Antibody |
ES6567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against PEG3 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PEG3 Polyclonal Antibody |
ES6567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against PEG3 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Anti-PEG3 antibody |
STJ114545 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: In human, ZIM2 and PEG3 are treated as two distinct genes though they share multiple 5' exons and a common promoter and both genes are paternally expressed (PMID:15203203). Alternative splicing events connect their shared 5' exons either with the remaining 4 exons unique to ZIM2, or with the remaining 2 exons unique to PEG3. In contrast, in other mammals ZIM2 does not undergo imprinting and, in mouse, cow, and likely other mammals as well, the ZIM2 and PEG3 genes do not share exons. Human PEG3 protein belongs to the Kruppel C2H2-type zinc finger protein family. PEG3 may play a role in cell proliferation and p53-mediated apoptosis. PEG3 has also shown tumor suppressor activity and tumorigenesis in glioma and ovarian cells. Alternative splicing of this PEG3 gene results in multiple transcript variants encoding distinct isoforms. |
Anti-PEG3 antibody |
STJ95024 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to PEG3. |
PEG3 siRNA |
20-abx928229 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PEG3 siRNA |
20-abx928230 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PEG3 Rabbit pAb |
A12671-100ul |
Abclonal |
100 ul |
EUR 308 |
PEG3 Rabbit pAb |
A12671-200ul |
Abclonal |
200 ul |
EUR 459 |
PEG3 Rabbit pAb |
A12671-20ul |
Abclonal |
20 ul |
EUR 183 |
PEG3 Rabbit pAb |
A12671-50ul |
Abclonal |
50 ul |
EUR 223 |
propargyl-PEG3-Acid |
20-abx180861 |
Abbexa |
|
|
- Shipped within 1-2 weeks.
|
N3-PEG3-NH2 |
20-abx186135 |
Abbexa |
|
|
- Shipped within 1-2 weeks.
|
N3-PEG3-OH |
20-abx186195 |
Abbexa |
|
|
- Shipped within 1-2 weeks.
|
Alkyne-PEG3-Alkyne |
20-abx186246 |
Abbexa |
|
|
- Shipped within 1-2 weeks.
|
OH-PEG3-CH2CH2COOtBu |
20-abx186258 |
Abbexa |
|
|
- Shipped within 1-2 weeks.
|
Biotin-PEG3-Azide |
abx186382-1g |
Abbexa |
1 g |
EUR 787 |
- Shipped within 1-2 weeks.
|
Methyl-PEG3-MS |
abx186609-250mg |
Abbexa |
250 mg |
EUR 439 |
- Shipped within 1-2 weeks.
|
NH2-PEG3-NH2 |
20-abx186613 |
Abbexa |
|
|
- Shipped within 1-2 weeks.
|
NH2-PEG3-COOH |
20-abx186616 |
Abbexa |
|
|
- Shipped within 1-2 weeks.
|
Bromo-PEG3-azide |
20-abx186630 |
Abbexa |
|
|
- Shipped within 1-2 weeks.
|
OH-PEG3-Tos |
20-abx085425 |
Abbexa |
|
|
- Shipped within 1-2 weeks.
|
Tos-PEG3-Tos |
20-abx085426 |
Abbexa |
|
|
- Shipped within 1-2 weeks.
|
COOH-PEG3-COOH |
20-abx085430 |
Abbexa |
|
|
- Shipped within 1-2 weeks.
|
PEG3 Blocking Peptide |
AF9152-BP |
Affbiotech |
1mg |
EUR 195 |
Azido-PEG3-FLAG |
H-7924.0500 |
Bachem |
0.5mg |
EUR 383 |
Description: Sum Formula: C50H75N13O24 |
Azido-PEG3-FLAG |
H-7924.1000 |
Bachem |
1.0mg |
EUR 618 |
Description: Sum Formula: C50H75N13O24 |
Paternally Expressed 3 (PEG3) Antibody |
20-abx013786 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
Paternally Expressed 3 (PEG3) Antibody |
abx331093-100ul |
Abbexa |
100 ul |
EUR 425 |
- Shipped within 5-10 working days.
|
Paternally Expressed 3 (PEG3) Antibody |
20-abx323448 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PEG3-tetrazine, 1 g |
1978-1g |
lumiprobe |
1 g |
EUR 661 |
PEG3-tetrazine, 250 mg |
1978-250mg |
lumiprobe |
250 mg |
EUR 305 |
Fmoc-nh-peg3-ch2cooh |
20-abx180768 |
Abbexa |
-
EUR 495.00
-
EUR 4114.00
-
EUR 1274.00
|
|
- Shipped within 1-2 weeks.
|
Boc-NH-PEG3-NH2 |
20-abx180877 |
Abbexa |
|
|
- Shipped within 1-2 weeks.
|
Mouse PEG3 shRNA Plasmid |
20-abx971994 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human PEG3 shRNA Plasmid |
20-abx953456 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Azide-PEG3-Azide, 1 g |
207-1g |
lumiprobe |
1 g |
EUR 101 |
Azide-PEG3-Azide, 5 g |
207-5g |
lumiprobe |
5 g |
EUR 320 |
Azide-PEG3-Amine, 1 g |
218-1g |
lumiprobe |
1 g |
EUR 93 |
Azide-PEG3-Amine, 5 g |
218-5g |
lumiprobe |
5 g |
EUR 230 |
PEG3 dicarboxylic acid, 10 g |
1715-10g |
lumiprobe |
10 g |
EUR 910 |
PEG3 dicarboxylic acid, 1 g |
1715-1g |
lumiprobe |
1 g |
EUR 353 |
PEG3 dicarboxylic acid, 5 g |
1715-5g |
lumiprobe |
5 g |
EUR 613 |
Alkyne-PEG3-COOH, 1 g |
1743-1g |
lumiprobe |
1 g |
EUR 349 |
Alkyne-PEG3-COOH, 5 g |
1743-5g |
lumiprobe |
5 g |
EUR 661 |
Alkyne-PEG3-OH, 1 g |
418-1g |
lumiprobe |
1 g |
EUR 93 |
Alkyne-PEG3-OH, 5 g |
418-5g |
lumiprobe |
5 g |
EUR 230 |
Biotin PEG3 azide, 25 mg |
D3730 |
lumiprobe |
25 mg |
EUR 97 |
Biotin PEG3 azide, 50 mg |
E3730 |
lumiprobe |
50 mg |
EUR 130 |
Biotin PEG3 azide, 10 mg |
C3730 |
lumiprobe |
10 mg |
EUR 60 |
Biotin PEG3 azide, 100 mg |
F3730 |
lumiprobe |
100 mg |
EUR 156 |
PEG3 ORF Vector (Human) (pORF) |
ORF027601 |
ABM |
1.0 ug DNA |
EUR 659 |
Peg3 ORF Vector (Mouse) (pORF) |
ORF053769 |
ABM |
1.0 ug DNA |
EUR 1572 |
TMP-PEG3-amine, trifluoroacetic acid salt |
91056 |
Biotium |
1MG |
EUR 195 |
Description: Minimum order quantity: 1 unit of 1MG |
Peg3 sgRNA CRISPR Lentivector set (Mouse) |
K4341801 |
ABM |
3 x 1.0 ug |
EUR 339 |
PEG3 sgRNA CRISPR Lentivector set (Human) |
K1626501 |
ABM |
3 x 1.0 ug |
EUR 339 |
PEG3-AS1 ORF Vector (Human) (pORF) |
ORF027602 |
ABM |
1.0 ug DNA |
Ask for price |
(S,R,S)-AHPC-PEG3-NH2 (hydrochloride) |
HY-103602 |
MedChemExpress |
25mg |
EUR 234 |
Thalidomide-O-amido-PEG3-C2-NH2 (TFA) |
HY-103611 |
MedChemExpress |
2g |
EUR 5675 |
Peg3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4341802 |
ABM |
1.0 ug DNA |
EUR 154 |
Peg3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4341803 |
ABM |
1.0 ug DNA |
EUR 154 |
Peg3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4341804 |
ABM |
1.0 ug DNA |
EUR 154 |
PEG3 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1626502 |
ABM |
1.0 ug DNA |
EUR 154 |
PEG3 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1626503 |
ABM |
1.0 ug DNA |
EUR 154 |
PEG3 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1626504 |
ABM |
1.0 ug DNA |
EUR 154 |
PEG3 Protein Vector (Human) (pPB-C-His) |
PV110402 |
ABM |
500 ng |
EUR 2280 |
PEG3 Protein Vector (Human) (pPB-N-His) |
PV110403 |
ABM |
500 ng |
EUR 2280 |
PEG3 Protein Vector (Human) (pPM-C-HA) |
PV110404 |
ABM |
500 ng |
EUR 2280 |
PEG3 Protein Vector (Human) (pPM-C-His) |
PV110405 |
ABM |
500 ng |
EUR 2280 |
PEG3 Protein Vector (Mouse) (pPB-C-His) |
PV215074 |
ABM |
500 ng |
EUR 2646 |
PEG3 Protein Vector (Mouse) (pPB-N-His) |
PV215075 |
ABM |
500 ng |
EUR 2646 |
PEG3 Protein Vector (Mouse) (pPM-C-HA) |
PV215076 |
ABM |
500 ng |
EUR 2646 |
PEG3 Protein Vector (Mouse) (pPM-C-His) |
PV215077 |
ABM |
500 ng |
EUR 2646 |
Peg3 3'UTR Luciferase Stable Cell Line |
TU116185 |
ABM |
1.0 ml |
Ask for price |
Peg3 3'UTR GFP Stable Cell Line |
TU166185 |
ABM |
1.0 ml |
Ask for price |
PEG3 3'UTR GFP Stable Cell Line |
TU067722 |
ABM |
1.0 ml |
EUR 2333 |
PEG3 3'UTR Luciferase Stable Cell Line |
TU017722 |
ABM |
1.0 ml |
EUR 2333 |
Anti-ERBB2 (trastuzumab)-Amino-PEG3-Propionyl-MMAE ADC |
ADC-W-629 |
Creative Biolabs |
1mg |
Ask for price |
Description: This ADC product is comprised of an engineerd anti-ERBB2 antibody (trastuzumab with LLQGG tag at Fc) conjugated via a Amino-PEG3-Propionyl linker to MMAE |
Mouse Paternally- expressed gene 3 protein, Peg3 ELISA KIT |
ELI-20913m |
Lifescience Market |
96 Tests |
EUR 865 |
Human Paternally- expressed gene 3 protein, PEG3 ELISA KIT |
ELI-22084h |
Lifescience Market |
96 Tests |
EUR 824 |
Bovine Paternally- expressed gene 3 protein, PEG3 ELISA KIT |
ELI-45910b |
Lifescience Market |
96 Tests |
EUR 928 |
PEG3-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
LV772727 |
ABM |
1.0 ug DNA |
Ask for price |
PEG3-AS1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV772731 |
ABM |
1.0 ug DNA |
Ask for price |
PEG3-AS1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV772732 |
ABM |
1.0 ug DNA |
Ask for price |
Peg3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse) |
K4341805 |
ABM |
3 x 1.0 ug |
EUR 376 |
PEG3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human) |
K1626505 |
ABM |
3 x 1.0 ug |
EUR 376 |
Peg3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3) |
K4341808 |
ABM |
1.0 ug DNA |
EUR 167 |
Peg3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1) |
K4341806 |
ABM |
1.0 ug DNA |
EUR 167 |
Peg3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2) |
K4341807 |
ABM |
1.0 ug DNA |
EUR 167 |
PEG3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1) |
K1626506 |
ABM |
1.0 ug DNA |
EUR 167 |
PEG3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2) |
K1626507 |
ABM |
1.0 ug DNA |
EUR 167 |
PEG3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3) |
K1626508 |
ABM |
1.0 ug DNA |
EUR 167 |
PEG3-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro) |
LV772729 |
ABM |
1.0 ug DNA |
Ask for price |
PEG3-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro) |
LV772730 |
ABM |
1.0 ug DNA |
Ask for price |
H2B Antibody Antibody |
AF4659 |
Affbiotech |
200ul |
EUR 376 |
Description: H2B Antibody Antibody detects endogenous levels of H2B. |
anti- Antibody^Polyclonal antibody control antibody |
LSMab09882 |
Lifescience Market |
100 ug |
EUR 438 |
Ly1 Antibody Reactive (LYAR) Antibody |
20-abx008109 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Anti-Glycolipid Antibody (AGA) Antibody |
20-abx004855 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Ly1 Antibody Reactive (LYAR) Antibody |
20-abx123734 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Anti-Glycolipid Antibody (AGA) Antibody |
abx036399-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Ly1 Antibody Reactive (LYAR) Antibody |
20-abx014333 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
Ly1 Antibody Reactive (LYAR) Antibody |
abx033330-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Ly1 Antibody Reactive (LYAR) Antibody |
abx033330-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Anti-Glycoprotein Antibody (GP) Antibody |
20-abx319900 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Anti-Glycoprotein Antibody (GP) Antibody |
20-abx319901 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Anti-Glycoprotein Antibody (GP) Antibody |
20-abx319905 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Anti-Glycoprotein Antibody (GP) Antibody |
20-abx319913 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Ly1 Antibody Reactive (LYAR) Antibody |
abx234901-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Ly1 Antibody Reactive (LYAR) Antibody |
20-abx324434 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Ly1 Antibody Reactive (LYAR) Antibody |
20-abx311665 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Anti-Glycolipid Antibody (AGA) Antibody |
abx230204-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Anti-Anti-SEPT6 antibody antibody |
STJ11100949 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis. One version of pediatric acute myeloid leukemia is the result of a reciprocal translocation between chromosomes 11 and X, with the breakpoint associated with the genes encoding the mixed-lineage leukemia and septin 2 proteins. This gene encodes four transcript variants encoding three distinct isoforms. An additional transcript variant has been identified, but its biological validity has not been determined. |
Anti-Anti-SEPT9 Antibody antibody |
STJ111369 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described. |
Anti-Anti-SEPT4 Antibody antibody |
STJ112276 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer. |
Anti-Anti-SEPT5 Antibody antibody |
STJ25477 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced. |
Anti-Anti-SEPT8 Antibody antibody |
STJ25479 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. |
Anti-Anti-SEPT7 Antibody antibody |
STJ28963 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19. |
Anti-Anti-SEPT5 Antibody antibody |
STJ114819 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced. |
Anti-Anti-SEPT7 Antibody antibody |
STJ116214 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19. |
Anti-Anti-SEPT8 Antibody antibody |
STJ117206 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. |
Anti-Anti-SEPT12 Antibody antibody |
STJ117759 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a guanine-nucleotide binding protein and member of the septin family of cytoskeletal GTPases. Septins play important roles in cytokinesis, exocytosis, embryonic development, and membrane dynamics. Multiple transcript variants encoding different isoforms have been found for this gene. |
Anti-Anti-SEPT1 antibody antibody |
STJ119580 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis and the maintenance of cellular morphology. This gene encodes a protein that can form homo- and heterooligomeric filaments, and may contribute to the formation of neurofibrillary tangles in Alzheimer's disease. Alternatively spliced transcript variants have been found but the full-length nature of these variants has not been determined. [provided by RefSeq, Dec 2012] |
Cytokeratin 7 antibody-Cytoskeleton Marker Antibody |
48169-100ul |
SAB |
100ul |
EUR 333 |
Cytokeratin 7 antibody-Cytoskeleton Marker Antibody |
48169-50ul |
SAB |
50ul |
EUR 239 |
Antibody Pair to ApoA-V antibody |
10R-1876 |
Fitzgerald |
100 ul |
EUR 651 |
Description: Mouse monoclonal Antibody Pair to ApoA-V antibody |
Anti CD22 Antibody: CD22 Monoclonal Antibody |
065-A-01mg |
Virogen |
0,1 mg |
EUR 267.5 |
- Category: Antibody, Signal Transduction Antibodies, mAb
|
Description: anti-CD22 monoclonal antibody |
Anti CD22 Antibody: CD22 Monoclonal Antibody |
065-A-1000ug |
Virogen |
1000 ug |
EUR 1282.5 |
- Category: Antibody, Signal Transduction Antibodies, mAb
|
Description: anti-CD22 monoclonal antibody |
Hepatitis C Virus Antibody (HCV) Antibody |
abx023924-1mg |
Abbexa |
1 mg |
EUR 1205 |
- Shipped within 5-10 working days.
|
Ly1 Antibody Reactive Homolog (LYAR) Antibody |
20-abx103034 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Ly1 Antibody Reactive Homolog (LYAR) Antibody |
20-abx103035 |
Abbexa |
-
EUR 467.00
-
EUR 133.00
-
EUR 1344.00
-
EUR 634.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
SUMO4 small interfering RNA attenuates invasion and migration through the JAK2/STAT3 pathway in non-small cell lung most cancers cells
- Small ubiquitin-like modifier 4 (SUMO4) is the most recent member of the sumoylation household, which boosts the steadiness of protein, regulates the distribution and localization of the protein, and impacts the transcription exercise of the protein. Nevertheless, the function of SUMO4 in non-small cell lung most cancers (NSCLC) has not but been reported.
- The current research first demonstrated that SUMO4 was upregulated in quite a lot of tissues from sufferers with NSCLC. Immunohistochemistry was carried out to display the expression degree of SUMO4 in lung most cancers tumor tissues. Following the transfection, The EMT standing and signaling pathway activation regulated by SUMO4-siRNA was assessed by western blotting.
- The Transwell and wound therapeutic assays had been carried out to research the regulatory impact of SUMO4-siRNA on cell migration and invasion. Cell Counting Equipment-Eight assay was carried out to research whether or not SUMO4-siRNA affected the chemosensitivity of the NSCLC cells to cisplatin. Statistical evaluation of immunohistochemical outcomes from the tissues confirmed that the overexpression of SUMO4 was considerably related to intercourse, tumor kind, historical past of smoking, T stage and poor prognosis.
- It was additionally recognized that SUMO4 small interfering RNA attenuated invasion and migration in NSCLC cell traces, as effectively chemosensitivity to cisplatin through the inhibition of the JAK2/STAT3 pathway. In conclusion, SUMO4 might play an essential function within the poor prognosis of sufferers with NSCLC. The current research signifies that SUMO4 could also be a possible therapeutic goal for NSCLC.
Low-cost RNA extraction technique for extremely scalable transcriptome research
RNA extraction has been improved by integration of quite a lot of supplies within the protocol, akin to phenol, guanidine thiocyanate, and silica, in line with the case-specific calls for. Nevertheless, few strategies have been designed for high-throughput RNA preparation for large-scale transcriptome research. On this research, we established a high-throughput guanidinium thiocyanate and isopropyl alcohol based mostly RNA extraction technique (HighGI).
HighGI relies on easy and phenol-free do-it-yourself buffers and the associated fee is considerably decrease than a column-based business package. We demonstrated that the standard and amount of RNA extracted with HighGI had been corresponding to these extracted with a typical phenol/chloroform-based technique and a column-based business package. HighGI retained small RNAs lower than 200 bp, that are misplaced with a business column-based package.
We additionally demonstrated that HighGI is quickly relevant to semi-automated RNA extraction. HighGI permits high-throughput RNA extraction for large-scale RNA preparation with excessive yield and high quality.
Anti-CGA antibody |
STJ23110 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The four human glycoprotein hormones chorionic gonadotropin (CG), luteinizing hormone (LH), follicle stimulating hormone (FSH), and thyroid stimulating hormone (TSH) are dimers consisting of alpha and beta subunits that are associated noncovalently. The alpha subunits of these hormones are identical, however, their beta chains are unique and confer biological specificity. The protein encoded by this gene is the alpha subunit and belongs to the glycoprotein hormones alpha chain family. Two transcript variants encoding different isoforms have been found for this gene. |
Rabbit Polyclonal antibody Anti-CRBN |
Anti-CRBN |
ImmunoStep |
50 µg |
EUR 349 |
Human Chorionic Gonadotropin Alpha Polypeptide (CGa) ELISA Kit |
DLR-CGa-Hu-48T |
DL Develop |
48T |
EUR 498 |
- Should the Human Chorionic Gonadotropin Alpha Polypeptide (CGa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Chorionic Gonadotropin Alpha Polypeptide (CGa) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Chorionic Gonadotropin Alpha Polypeptide (CGa) ELISA Kit |
DLR-CGa-Hu-96T |
DL Develop |
96T |
EUR 647 |
- Should the Human Chorionic Gonadotropin Alpha Polypeptide (CGa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Chorionic Gonadotropin Alpha Polypeptide (CGa) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Chorionic Gonadotropin Alpha Polypeptide (CGa) ELISA Kit |
RDR-CGa-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 522 |
Human Chorionic Gonadotropin Alpha Polypeptide (CGa) ELISA Kit |
RDR-CGa-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 724 |
Human Chorionic Gonadotropin Alpha Polypeptide (CGa) ELISA Kit |
RD-CGa-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Chorionic Gonadotropin Alpha Polypeptide (CGa) ELISA Kit |
RD-CGa-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
CGA Antibody |
32250-100ul |
SAB |
100ul |
EUR 252 |
CgA antibody |
10R-2291 |
Fitzgerald |
1 mL |
EUR 584 |
Description: Mouse monoclonal CgA antibody |
CGA Antibody |
CSB-PA005293KA01HU- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
|
Description: A polyclonal antibody against CGA. Recognizes CGA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200 |
CGA Antibody |
CSB-PA005293KA01HU-100ul |
Cusabio |
100ul |
EUR 389 |
- Form: liquid
- Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
|
Description: A polyclonal antibody against CGA. Recognizes CGA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200 |
CGA Antibody |
1-CSB-PA131153 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against CGA. Recognizes CGA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200 |
CGA Antibody |
DF6371 |
Affbiotech |
200ul |
EUR 304 |
Description: CGA Antibody detects endogenous levels of total CGA. |
CGA Antibody |
1-CSB-PA292680 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against CGA. Recognizes CGA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200 |
CGA Conjugated Antibody |
C32250 |
SAB |
100ul |
EUR 397 |
Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody |
BNUM1060-50 |
Biotium |
50uL |
EUR 395 |
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), 1mg/mL |
Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody |
BNUB1060-100 |
Biotium |
100uL |
EUR 209 |
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), Concentration: 0.2mg/mL |
Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody |
BNUB1060-500 |
Biotium |
500uL |
EUR 458 |
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), Concentration: 0.2mg/mL |
Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody |
BNC551060-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF555 conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody |
BNC551060-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF555 conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody |
BNC611060-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF660R conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody |
BNC611060-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF660R conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody |
BNC471060-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF647 conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody |
BNC471060-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF647 conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody |
BNC051060-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF405M conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody |
BNC051060-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF405M conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody |
BNC401060-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF640R conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody |
BNC401060-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF640R conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody |
BNC431060-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF543 conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody |
BNC431060-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF543 conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody |
BNC041060-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF405S conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody |
BNC041060-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF405S conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody |
BNC801060-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF680 conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody |
BNC801060-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF680 conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody |
BNCP1060-250 |
Biotium |
250uL |
EUR 383 |
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), PerCP conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody |
BNCR1060-250 |
Biotium |
250uL |
EUR 383 |
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), RPE conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody |
BNCA1060-250 |
Biotium |
250uL |
EUR 383 |
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), APC conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody |
BNCAP1060-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody |
BNCAP1060-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody |
BNCB1060-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), Biotin conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody |
BNCB1060-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), Biotin conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody |
BNCH1060-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody |
BNCH1060-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody |
BNC881060-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF488A conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody |
BNC881060-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF488A conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody |
BNC941060-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF594 conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody |
BNC941060-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF594 conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody |
BNC681060-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF568 conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody |
BNC681060-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF568 conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody |
BNC701060-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF770 conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody |
BNC701060-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF770 conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody |
BNC811060-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF680R conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody |
BNC811060-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF680R conjugate, Concentration: 0.1mg/mL |
Polyclonal Goat anti-GST α-form |
GST-ANTI-1 |
Detroit R&D |
50 uL |
EUR 280 |
Polyclonal Goat anti-GST μ-form |
GST-ANTI-2 |
Detroit R&D |
50 uL |
EUR 280 |
Polyclonal Goat anti-GST p-form |
GST-ANTI-3 |
Detroit R&D |
50 uL |
EUR 280 |
CGA siRNA |
20-abx911610 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CGA siRNA |
20-abx911611 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Polyclonal CGA / hCG Alpha Antibody |
APG02559G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human CGA / hCG Alpha . This antibody is tested and proven to work in the following applications: |
Monoclonal CGA Antibody, Clone: 2E6B3 |
APG02561G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A Monoclonal antibody against Human CGA. The antibodies are raised in Mouse and are from clone 2E6B3. This antibody is applicable in WB, E |
Monoclonal CGA Antibody, Clone: EP3373 |
APG02562G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A Monoclonal antibody against Human CGA. The antibodies are raised in Rabbit and are from clone EP3373. This antibody is applicable in WB and IHC |
Chromogranin A(CGA/414) Antibody |
BNUB0414-100 |
Biotium |
100uL |
EUR 209 |
Description: Primary antibody against Chromogranin A(CGA/414), Concentration: 0.2mg/mL |
Chromogranin A(CGA/414) Antibody |
BNUB0414-500 |
Biotium |
500uL |
EUR 458 |
Description: Primary antibody against Chromogranin A(CGA/414), Concentration: 0.2mg/mL |
Chromogranin A(CGA/414) Antibody |
BNUM0414-50 |
Biotium |
50uL |
EUR 395 |
Description: Primary antibody against Chromogranin A(CGA/414), 1mg/mL |
Chromogranin A(CGA/414) Antibody |
BNC040414-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against Chromogranin A(CGA/414), CF405S conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA/414) Antibody |
BNC040414-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against Chromogranin A(CGA/414), CF405S conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA/414) Antibody |
BNC610414-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against Chromogranin A(CGA/414), CF660R conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA/414) Antibody |
BNC610414-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against Chromogranin A(CGA/414), CF660R conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA/414) Antibody |
BNC470414-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against Chromogranin A(CGA/414), CF647 conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA/414) Antibody |
BNC470414-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against Chromogranin A(CGA/414), CF647 conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA/414) Antibody |
BNC550414-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against Chromogranin A(CGA/414), CF555 conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA/414) Antibody |
BNC550414-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against Chromogranin A(CGA/414), CF555 conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA/414) Antibody |
BNC050414-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against Chromogranin A(CGA/414), CF405M conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA/414) Antibody |
BNC050414-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against Chromogranin A(CGA/414), CF405M conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA/414) Antibody |
BNC400414-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against Chromogranin A(CGA/414), CF640R conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA/414) Antibody |
BNC400414-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against Chromogranin A(CGA/414), CF640R conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA/414) Antibody |
BNC430414-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against Chromogranin A(CGA/414), CF543 conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA/414) Antibody |
BNC430414-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against Chromogranin A(CGA/414), CF543 conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA/414) Antibody |
BNC800414-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against Chromogranin A(CGA/414), CF680 conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA/414) Antibody |
BNC800414-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against Chromogranin A(CGA/414), CF680 conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA/414) Antibody |
BNC810414-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against Chromogranin A(CGA/414), CF680R conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA/414) Antibody |
BNC810414-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against Chromogranin A(CGA/414), CF680R conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA/414) Antibody |
BNCP0414-250 |
Biotium |
250uL |
EUR 383 |
Description: Primary antibody against Chromogranin A(CGA/414), PerCP conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA/414) Antibody |
BNCR0414-250 |
Biotium |
250uL |
EUR 383 |
Description: Primary antibody against Chromogranin A(CGA/414), RPE conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA/414) Antibody |
BNCA0414-250 |
Biotium |
250uL |
EUR 383 |
Description: Primary antibody against Chromogranin A(CGA/414), APC conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA/414) Antibody |
BNCAP0414-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against Chromogranin A(CGA/414), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA/414) Antibody |
BNCAP0414-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against Chromogranin A(CGA/414), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA/414) Antibody |
BNCH0414-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against Chromogranin A(CGA/414), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA/414) Antibody |
BNCH0414-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against Chromogranin A(CGA/414), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA/414) Antibody |
BNC940414-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against Chromogranin A(CGA/414), CF594 conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA/414) Antibody |
BNC940414-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against Chromogranin A(CGA/414), CF594 conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA/414) Antibody |
BNC700414-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against Chromogranin A(CGA/414), CF770 conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA/414) Antibody |
BNC700414-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against Chromogranin A(CGA/414), CF770 conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA/414) Antibody |
BNCB0414-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against Chromogranin A(CGA/414), Biotin conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA/414) Antibody |
BNCB0414-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against Chromogranin A(CGA/414), Biotin conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA/414) Antibody |
BNC880414-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against Chromogranin A(CGA/414), CF488A conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA/414) Antibody |
BNC880414-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against Chromogranin A(CGA/414), CF488A conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA/414) Antibody |
BNC680414-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against Chromogranin A(CGA/414), CF568 conjugate, Concentration: 0.1mg/mL |
Chromogranin A(CGA/414) Antibody |
BNC680414-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against Chromogranin A(CGA/414), CF568 conjugate, Concentration: 0.1mg/mL |
CGA Rabbit pAb |
A1239-100ul |
Abclonal |
100 ul |
EUR 308 |
CGA Rabbit pAb |
A1239-200ul |
Abclonal |
200 ul |
EUR 459 |
CGA Rabbit pAb |
A1239-20ul |
Abclonal |
20 ul |
EUR 183 |
CGA Rabbit pAb |
A1239-50ul |
Abclonal |
50 ul |
EUR 223 |
CGA Blocking Peptide |
DF6371-BP |
Affbiotech |
1mg |
EUR 195 |
CGA cloning plasmid |
CSB-CL005293HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 351
- Sequence: atggattactacagaaaatatgcagctatctttctggtcacattgtcggtgtttctgcatgttctccattccgctcctgatgtgcaggattgcccagaatgcacgctacaggaaaacccactcttctcccagccgggtgccccaatacttcagtgcatgggctgctgcttctctag
- Show more
|
Description: A cloning plasmid for the CGA gene. |
CGA cloning plasmid |
CSB-CL005293HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 351
- Sequence: atggattactacagaaaatatgcagctatctttctggtcacattgtcggtgtttctgcatgttctccattccgctcctgatgtgcaggattgcccagaatgcacgctacaggaaaacccattcttctcccagccgggtgccccaatacttcagtgcatgggctgctgcttctctag
- Show more
|
Description: A cloning plasmid for the CGA gene. |
Anti-Chromogranin A/ CHGA Antibody Clone CGA/414, Unconjugated-100ug |
1113-MSM1-P1 |
EnQuireBio |
100ug |
EUR 428 |
Anti-Chromogranin A/ CHGA Antibody Clone CGA/413, Unconjugated-100ug |
1113-MSM9-P1 |
EnQuireBio |
100ug |
EUR 428 |
Glycoprotein Hormones Alpha Chain (CGA) Antibody |
abx215829-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
Glycoprotein Hormones Alpha Chain (CGA) Antibody |
abx224103-100ug |
Abbexa |
100 ug |
EUR 411 |
- Shipped within 5-10 working days.
|
Glycoprotein Hormones Alpha Chain (CGA) Antibody |
20-abx210782 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Glycoprotein Hormones Alpha Chain (CGA) Antibody |
20-abx210783 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Chorionic Gonadotropin Alpha Polypeptide (CGa) Antibody |
20-abx104052 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1149.00
-
EUR 565.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Chorionic Gonadotropin Alpha Polypeptide (CGa) Antibody |
20-abx104053 |
Abbexa |
-
EUR 300.00
-
EUR 133.00
-
EUR 801.00
-
EUR 425.00
-
EUR 258.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Glycoprotein Hormones Alpha Chain (CGA) Antibody |
abx117075-100ug |
Abbexa |
100 ug |
EUR 467 |
- Shipped within 5-10 working days.
|
Chorionic Gonadotropin Alpha Polypeptide (CGa) Antibody |
20-abx171737 |
Abbexa |
-
EUR 328.00
-
EUR 815.00
-
EUR 425.00
-
EUR 154.00
-
EUR 258.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Glycoprotein Hormones Alpha Chain (CGA) Antibody |
20-abx225107 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Glycoprotein Hormones Alpha Chain (CGA) Antibody |
20-abx001151 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Mouse CGA shRNA Plasmid |
20-abx969656 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human CGA shRNA Plasmid |
20-abx950777 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
CGA Recombinant Protein (Human) |
RP006901 |
ABM |
100 ug |
Ask for price |
CGA Recombinant Protein (Human) |
RP006904 |
ABM |
100 ug |
Ask for price |
CGA Recombinant Protein (Rat) |
RP194735 |
ABM |
100 ug |
Ask for price |
CGA Recombinant Protein (Mouse) |
RP123761 |
ABM |
100 ug |
Ask for price |
Human CGA ELISA Kit |
STJ150209 |
St John's Laboratory |
1 kit |
EUR 412 |
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of HCG in human serum, plasma and other biological fluids |
Anti-Chromogranin A / CHGA Antibody (CGA/413 + CHGA/777 + CHGA/798) |
A1576-100 |
Biovision |
|
EUR 479 |
Chorionic Gonadotropin Alpha Polypeptide (CGa) Antibody (Biotin) |
20-abx272165 |
Abbexa |
-
EUR 439.00
-
EUR 244.00
-
EUR 1261.00
-
EUR 606.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Chorionic Gonadotropin Alpha Polypeptide (CGa) Antibody (Biotin) |
20-abx272885 |
Abbexa |
-
EUR 467.00
-
EUR 244.00
-
EUR 1344.00
-
EUR 634.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Chorionic Gonadotropin Alpha Polypeptide (CGa) Antibody (FITC) |
20-abx273928 |
Abbexa |
-
EUR 495.00
-
EUR 258.00
-
EUR 1455.00
-
EUR 676.00
-
EUR 398.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Anti-Chromogranin A/ CHGA Antibody Clone LK2H10 + PHE5 + CGA/414, Unconjugated-100ug |
1113-MSM5-P1 |
EnQuireBio |
100ug |
EUR 428 |
Human Chromogranin,CgA ELISA Kit |
201-12-1731 |
SunredBio |
96 tests |
EUR 440 |
- This Chromogranin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Chromogranin,CgA ELISA Kit |
CN-04332H1 |
ChemNorm |
96T |
EUR 486 |
Human Chromogranin,CgA ELISA Kit |
CN-04332H2 |
ChemNorm |
48T |
EUR 336 |
Human Chromogranin, CgA ELISA Kit |
CSB-E09153h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Chromogranin, CgA in samples from serum, plasma, cell culture supernates, urine, cerebrospinalfluid (CSF). A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Chromogranin, CgA ELISA Kit |
1-CSB-E09153h |
Cusabio |
-
EUR 900.00
-
EUR 5476.00
-
EUR 2900.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Chromogranin, CgA in samples from serum, plasma, cell culture supernates, urine, cerebrospinalfluid(CSF). Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Chromogranin A (CgA) ELISA Kit |
K4241-100 |
Biovision |
|
EUR 914 |
Cga ORF Vector (Rat) (pORF) |
ORF064913 |
ABM |
1.0 ug DNA |
EUR 506 |
CGA ORF Vector (Human) (pORF) |
ORF002301 |
ABM |
1.0 ug DNA |
EUR 95 |
CGA ORF Vector (Human) (pORF) |
ORF002302 |
ABM |
1.0 ug DNA |
EUR 95 |
Cga ORF Vector (Mouse) (pORF) |
ORF041255 |
ABM |
1.0 ug DNA |
EUR 506 |
CGA ELISA Kit (Human) (OKAN04321) |
OKAN04321 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: The four human glycoprotein hormones chorionic gonadotropin (CG), luteinizing hormone (LH), follicle stimulating hormone (FSH), and thyroid stimulating hormone (TSH) are dimers consisting of alpha and beta subunits that are associated noncovalently. The alpha subunits of these hormones are identical, however, their beta chains are unique and confer biological specificity. The protein encoded by this gene is the alpha subunit and belongs to the glycoprotein hormones alpha chain family. Two transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.34 mIU/mL |
CGA ELISA Kit (Goat) (OKCA00590) |
OKCA00590 |
Aviva Systems Biology |
96 Wells |
EUR 728 |
Description: Description of target: ;Species reactivity: Goat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.25 uIU/mL |
CGA ELISA Kit (Human) (OKCD06874) |
OKCD06874 |
Aviva Systems Biology |
96 Wells |
EUR 635 |
Description: Description of target: The four human glycoprotein hormones chorionic gonadotropin (CG), luteinizing hormone (LH), follicle stimulating hormone (FSH), and thyroid stimulating hormone (TSH) are dimers consisting of alpha and beta subunits that are associated noncovalently. The alpha subunits of these hormones are identical, however, their beta chains are unique and confer biological specificity. The protein encoded by this gene is the alpha subunit and belongs to the glycoprotein hormones alpha chain family. Two transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.34mIU/mL |
CGA ELISA Kit (Mouse) (OKCD06875) |
OKCD06875 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
Description: Description of target: The four human glycoprotein hormones chorionic gonadotropin (CG), luteinizing hormone (LH), follicle stimulating hormone (FSH), and thyroid stimulating hormone (TSH) are dimers consisting of alpha and beta subunits that are associated noncovalently. The alpha subunits of these hormones are identical, however, their beta chains are unique and confer biological specificity. The protein encoded by this gene is the alpha subunit and belongs to the glycoprotein hormones alpha chain family. Two transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.82ng/mL |
CGA ELISA Kit (Human) (OKCD07526) |
OKCD07526 |
Aviva Systems Biology |
96 Wells |
EUR 936 |
Description: Description of target: The four human glycoprotein hormones chorionic gonadotropin (CG), luteinizing hormone (LH), follicle stimulating hormone (FSH), and thyroid stimulating hormone (TSH) are dimers consisting of alpha and beta subunits that are associated noncovalently. The alpha subunits of these hormones are identical, however, their beta chains are unique and confer biological specificity. The protein encoded by this gene is the alpha subunit and belongs to the glycoprotein hormones alpha chain family. Two transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.057ng/mL |
CGA ELISA Kit (Pig) (OKEH07390) |
OKEH07390 |
Aviva Systems Biology |
96 Wells |
EUR 648 |
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.2ng/mL |
CGA ELISA Kit (Mouse) (OKEH02958) |
OKEH02958 |
Aviva Systems Biology |
96 Wells |
EUR 414 |
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 1.56uIU/mL |
CGA ELISA Kit (Fish) (OKEH03759) |
OKEH03759 |
Aviva Systems Biology |
96 Wells |
EUR 479 |
Description: Description of target: ;Species reactivity: Fish;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.32mIU/mL |
CGA ELISA Kit (Bovine) (OKEH03760) |
OKEH03760 |
Aviva Systems Biology |
96 Wells |
EUR 479 |
Description: Description of target: ;Species reactivity: Bovine;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.22mIU/mL |
CGA ELISA Kit (Dog) (OKEH03761) |
OKEH03761 |
Aviva Systems Biology |
96 Wells |
EUR 479 |
Description: Description of target: ;Species reactivity: Dog;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.2mIU/mL |
Chorionic Gonadotropin Alpha Polypeptide (CGa) Monoclonal Antibody (Human) |
4-MAB612Hu22 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2516.00
-
EUR 626.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Mouse monoclonal antibody against Human Chorionic Gonadotropin Alpha Polypeptide (CGa) |
Chorionic Gonadotropin Alpha Polypeptide (CGa) Polyclonal Antibody (Human) |
4-PAB612Hu01 |
Cloud-Clone |
-
EUR 239.00
-
EUR 2391.00
-
EUR 598.00
-
EUR 299.00
-
EUR 211.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Leu25~Ser120
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Chorionic Gonadotropin Alpha Polypeptide (CGa) |
Chorionic Gonadotropin Alpha Polypeptide (CGa) Polyclonal Antibody (Mouse) |
4-PAB612Mu01 |
Cloud-Clone |
-
EUR 243.00
-
EUR 2457.00
-
EUR 613.00
-
EUR 305.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CGa (Leu25~Ser120)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Chorionic Gonadotropin Alpha Polypeptide (CGa) |
Human CGA(Chromogranin A) ELISA Kit |
EH0486 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.781-50 ng/ml
- Uniprot ID: P10645
- Alias: CGA(Chromogranin A)
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469 ng/ml |
Human Chromogranin A(CgA)ELISA Kit |
GA-E1747HM-48T |
GenAsia Biotech |
48T |
EUR 289 |