RNA attenuates invasion and migration through the JAK2/STAT3 pathway in non-small cell lung

Identification of diagnostic and prognostic biomarkers, and candidate focused brokers for hepatitis B virus-associated early stage hepatocellular carcinoma based mostly on RNA-sequencing information

 

• Major liver most cancers is a quickly progressing neoplasm with excessive morbidity and mortality charges. The current research aimed to determine potential diagnostic and prognostic biomarkers, and candidate focused brokers for hepatitis B virus (HBV)-associated early stage hepatocellular carcinoma (HCC). The gene expression profiles had been extracted from the Gene Expression Omnibus database.

 

• Differentially expressed genes (DEGs), hub genes and the enrichment of signaling pathways had been filtered out through a high-throughput sequencing technique. The affiliation between hub genes and the results of the irregular expression of hub genes on the speed of genetic variation, total survival (OS), relapse-free survival (RFS), progression-free survival (PFS) and disease-free survival (DSS) of sufferers with HCC, in addition to pathological stage and grade, had been analyzed utilizing completely different databases. A complete of 1,582 DEGs had been recognized.

 

 

• Gene Ontology evaluation revealed that the DEGs had been primarily concerned within the ‘oxidation-reduction course of’, ‘steroid metabolic course of’, ‘metabolic course of’ and ‘fatty acid beta-oxidation’. Enrichment evaluation of Kyoto Encyclopedia of Genes and Genomes pathways revealed that the DEGs had been primarily related to ‘metabolic pathways’, ‘PPAR signaling pathway’, ‘fatty acid degradation’ and the ‘cell cycle’.

 

• A complete of Eight hub genes had been extracted. Moreover, the irregular expression ranges of hub genes had been intently related to the OS, RFS, PFS and DSS of sufferers, the pathological stage and the grade. Moreover, irregular expression ranges of the Eight hub genes had been present in >30% of all samples.

 

 

• A number of small molecular compounds which will reverse the altered DEGs had been recognized based mostly on Connectivity Map evaluation, together with phenoxybenzamine, GW-8510, resveratrol, 0175029-0000 and daunorubicin. In conclusion, the dysfunction of fats metabolic pathways, the cell cycle, oxidation-reduction processes and viral carcinogenesis might serve vital roles within the incidence of HBV-associated early stage HCC. The recognized Eight hub genes might act as strong biomarkers for prognosis and prognosis. Some small molecular compounds could also be promising focused brokers in opposition to HBV-associated early stage HCC.

 

PEG3 Antibody
34056-100ul	SAB	100ul	EUR 252.00

PEG3 Antibody
34056-50ul	SAB	50ul	EUR 187.00

PEG3 Antibody
43302-100ul	SAB	100ul	EUR 252.00

PEG3 Antibody
1-CSB-PA030033	Cusabio	EUR 222.00 EUR 195.00	0 1
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PEG3. Recognizes PEG3 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

PEG3 Antibody
CSB-PA022042-	Cusabio		EUR 335.00
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against PEG3. Recognizes PEG3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

PEG3 Antibody
CSB-PA022042-100ul	Cusabio	100ul	EUR 316.00
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against PEG3. Recognizes PEG3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

PEG3 Antibody
AF9152	Affbiotech	200ul	EUR 304.00
Description: PEG3 Antibody detects endogenous levels of total PEG3.

PEG3 Antibody
ABF9152	Lifescience Market	100 ug	EUR 438.00

Anti-PEG3 Antibody
A02541	BosterBio	100ul	EUR 397.00
Description: Rabbit Polyclonal PEG3 Antibody. Validated in WB and tested in Human.

PEG3 Conjugated Antibody
C34056	SAB	100ul	EUR 397.00

PEG3 Polyclonal Antibody
ABP55568-003ml	Abbkine	0.03ml	EUR 158.00
Immunogen information: Synthesized peptide derived from the Internal region of human PEG3 at AA range: 1010-1090 Applications tips:
Description: A polyclonal antibody for detection of PEG3 from Human. This PEG3 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PEG3 at AA range: 1010-1090

PEG3 Polyclonal Antibody
ABP55568-01ml	Abbkine	0.1ml	EUR 289.00
Immunogen information: Synthesized peptide derived from the Internal region of human PEG3 at AA range: 1010-1090 Applications tips:
Description: A polyclonal antibody for detection of PEG3 from Human. This PEG3 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PEG3 at AA range: 1010-1090

PEG3 Polyclonal Antibody
ABP55568-02ml	Abbkine	0.2ml	EUR 414.00
Immunogen information: Synthesized peptide derived from the Internal region of human PEG3 at AA range: 1010-1090 Applications tips:
Description: A polyclonal antibody for detection of PEG3 from Human. This PEG3 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PEG3 at AA range: 1010-1090

PEG3 Polyclonal Antibody
ES6567-100ul	ELK Biotech	100ul	EUR 279.00
Description: A Rabbit Polyclonal antibody against PEG3 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

PEG3 Polyclonal Antibody
ES6567-50ul	ELK Biotech	50ul	EUR 207.00
Description: A Rabbit Polyclonal antibody against PEG3 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-PEG3 antibody
STJ114545	St John's Laboratory	100 µl	EUR 277.00
Description: In human, ZIM2 and PEG3 are treated as two distinct genes though they share multiple 5' exons and a common promoter and both genes are paternally expressed (PMID:15203203). Alternative splicing events connect their shared 5' exons either with the remaining 4 exons unique to ZIM2, or with the remaining 2 exons unique to PEG3. In contrast, in other mammals ZIM2 does not undergo imprinting and, in mouse, cow, and likely other mammals as well, the ZIM2 and PEG3 genes do not share exons. Human PEG3 protein belongs to the Kruppel C2H2-type zinc finger protein family. PEG3 may play a role in cell proliferation and p53-mediated apoptosis. PEG3 has also shown tumor suppressor activity and tumorigenesis in glioma and ovarian cells. Alternative splicing of this PEG3 gene results in multiple transcript variants encoding distinct isoforms.

Anti-PEG3 antibody
STJ95024	St John's Laboratory	200 µl	EUR 197.00
Description: Rabbit polyclonal to PEG3.

PEG3 siRNA
20-abx928229	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

PEG3 siRNA
20-abx928230	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

NH2-PEG3
HY-W007545	MedChemExpress	100mg	EUR 108.00

PEG3 Rabbit pAb
A12671-100ul	Abclonal	100 ul	EUR 308.00

PEG3 Rabbit pAb
A12671-200ul	Abclonal	200 ul	EUR 459.00

PEG3 Rabbit pAb
A12671-20ul	Abclonal	20 ul	EUR 183.00

PEG3 Rabbit pAb
A12671-50ul	Abclonal	50 ul	EUR 223.00

propargyl-PEG3-Acid
20-abx180861	Abbexa	EUR 509.00 EUR 690.00	0 1
Shipped within 1-2 weeks.

N3-PEG3-NH2
20-abx186135	Abbexa	EUR 272.00 EUR 467.00	0 1
Shipped within 1-2 weeks.

N3-PEG3-OH
20-abx186195	Abbexa	EUR 370.00 EUR 829.00	0 1
Shipped within 1-2 weeks.

Alkyne-PEG3-Alkyne
20-abx186246	Abbexa	EUR 537.00 EUR 829.00	0 1
Shipped within 1-2 weeks.

OH-PEG3-CH2CH2COOtBu
20-abx186258	Abbexa	EUR 244.00 EUR 439.00	0 1
Shipped within 1-2 weeks.

Biotin-PEG3-Azide
abx186382-1g	Abbexa	1 g	EUR 787.00
Shipped within 1-2 weeks.

Methyl-PEG3-MS
abx186609-250mg	Abbexa	250 mg	EUR 439.00
Shipped within 1-2 weeks.

NH2-PEG3-NH2
20-abx186613	Abbexa	EUR 300.00 EUR 606.00	0 1
Shipped within 1-2 weeks.

NH2-PEG3-COOH
20-abx186616	Abbexa	EUR 537.00 EUR 1595.00	0 1
Shipped within 1-2 weeks.

Bromo-PEG3-azide
20-abx186630	Abbexa	EUR 370.00 EUR 746.00	0 1
Shipped within 1-2 weeks.

OH-PEG3-Tos
20-abx085425	Abbexa	EUR 648.00 EUR 1233.00	0 1
Shipped within 1-2 weeks.

Tos-PEG3-Tos
20-abx085426	Abbexa	EUR 217.00 EUR 272.00	0 1
Shipped within 1-2 weeks.

COOH-PEG3-COOH
20-abx085430	Abbexa	EUR 676.00 EUR 843.00	0 1
Shipped within 1-2 weeks.

NHS-PEG3-NHS
ADC-L-121	Creative Biolabs	unit	Ask for price

PEG3 Blocking Peptide
AF9152-BP	Affbiotech	1mg	EUR 195.00

VH032-PEG3-acetylene
HY-128767	MedChemExpress	5mg	EUR 113.00

Azido-PEG3-FLAG
H-7924.0500	Bachem	0.5mg	EUR 383.00
Description: Sum Formula: C50H75N13O24

Azido-PEG3-FLAG
H-7924.1000	Bachem	1.0mg	EUR 618.00
Description: Sum Formula: C50H75N13O24

N3-PEG3-CH2COOH
HY-42637	MedChemExpress	100mg	EUR 153.00

Amine-PEG3-Biotin
HY-111377	MedChemExpress	10mg	EUR 211.00

Boc-NH-PEG3
HY-W017772	MedChemExpress	100mg	EUR 142.00

Paternally Expressed 3 (PEG3) Antibody
20-abx013786	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	0 1 2 3
Shipped within 5-10 working days.

Paternally Expressed 3 (PEG3) Antibody
abx331093-100ul	Abbexa	100 ul	EUR 425.00
Shipped within 5-10 working days.

Paternally Expressed 3 (PEG3) Antibody
20-abx323448	Abbexa	EUR 314.00 EUR 244.00	0 1
Shipped within 5-10 working days.

PEG3-tetrazine, 1 g
1978-1g	lumiprobe	1 g	EUR 661.00

PEG3-tetrazine, 250 mg
1978-250mg	lumiprobe	250 mg	EUR 305.00

Fmoc-nh-peg3-ch2cooh
20-abx180768	Abbexa	EUR 495.00 EUR 4114.00 EUR 1274.00	0 1 2
Shipped within 1-2 weeks.

Boc-NH-PEG3-NH2
20-abx180877	Abbexa	EUR 551.00 EUR 1219.00	0 1
Shipped within 1-2 weeks.

Bis-PEG3-NHS Ester
ADC-L-120	Creative Biolabs	unit	Ask for price

Mouse PEG3 shRNA Plasmid
20-abx971994	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Human PEG3 shRNA Plasmid
20-abx953456	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

NH2-PEG3-C1-Boc
HY-128801	MedChemExpress	100mg	EUR 131.00

Azide-PEG3-Azide, 1 g
207-1g	lumiprobe	1 g	EUR 101.00

Azide-PEG3-Azide, 5 g
207-5g	lumiprobe	5 g	EUR 320.00

Azide-PEG3-Amine, 1 g
218-1g	lumiprobe	1 g	EUR 93.00

Azide-PEG3-Amine, 5 g
218-5g	lumiprobe	5 g	EUR 230.00

PEG3 dicarboxylic acid, 10 g
1715-10g	lumiprobe	10 g	EUR 910.00

PEG3 dicarboxylic acid, 1 g
1715-1g	lumiprobe	1 g	EUR 353.00

PEG3 dicarboxylic acid, 5 g
1715-5g	lumiprobe	5 g	EUR 613.00

Alkyne-PEG3-COOH, 1 g
1743-1g	lumiprobe	1 g	EUR 349.00

Alkyne-PEG3-COOH, 5 g
1743-5g	lumiprobe	5 g	EUR 661.00

Alkyne-PEG3-OH, 1 g
418-1g	lumiprobe	1 g	EUR 93.00

Alkyne-PEG3-OH, 5 g
418-5g	lumiprobe	5 g	EUR 230.00

Biotin PEG3 azide, 25 mg
D3730	lumiprobe	25 mg	EUR 97.00

Biotin PEG3 azide, 50 mg
E3730	lumiprobe	50 mg	EUR 130.00

Biotin PEG3 azide, 10 mg
C3730	lumiprobe	10 mg	EUR 60.00

N3-PEG3-C2-NHS ester
HY-126528	MedChemExpress	500mg	EUR 3264.00

Pomalidomide-PEG3-C2-NH2 (TFA)
HY-128716A	MedChemExpress	2g	EUR 5675.00

NHPI-PEG3-C2-Pfp ester
HY-130092	MedChemExpress	100mg	EUR 843.00

NHPI-PEG3-C2-NHS ester
HY-130093	MedChemExpress	100mg	EUR 843.00

NH2-PEG3-C2-NH-Boc
HY-42776	MedChemExpress	100mg	EUR 108.00

N3-PEG3-vc-PAB-MMAE
HY-100874	MedChemExpress	5mg	EUR 1221.00

Biotin PEG3 azide, 100 mg
F3730	lumiprobe	100 mg	EUR 156.00

PEG3 ORF Vector (Human) (pORF)
ORF027601	ABM	1.0 ug DNA	EUR 659.00

Peg3 ORF Vector (Mouse) (pORF)
ORF053769	ABM	1.0 ug DNA	EUR 1572.00

TMP-PEG3-amine, trifluoroacetic acid salt
91056	Biotium	1MG	EUR 195.00
Description: Minimum order quantity: 1 unit of 1MG

Ald-Ph-amido-PEG3-C-COOH
HY-130098	MedChemExpress	100mg	EUR 578.00

Ald-Ph-amido-PEG3-C1-Boc
HY-130100	MedChemExpress	100mg	EUR 843.00

(S,R,S)-AHPC-PEG3-N3
HY-103598	MedChemExpress	2g	EUR 5675.00

(S,R,S)-AHPC-PEG3-NH2
HY-103602A	MedChemExpress	1g	EUR 3896.00

Thalidomide-O-amido-PEG3-C2-NH2
HY-107440	MedChemExpress	2g	EUR 5675.00

Peg3 sgRNA CRISPR Lentivector set (Mouse)
K4341801	ABM	3 x 1.0 ug	EUR 339.00

PEG3 sgRNA CRISPR Lentivector set (Human)
K1626501	ABM	3 x 1.0 ug	EUR 339.00

PEG3-AS1 ORF Vector (Human) (pORF)
ORF027602	ABM	1.0 ug DNA	Ask for price

Ald-Ph-amido-PEG3-C2-Pfp ester
HY-130102	MedChemExpress	100mg	EUR 843.00

(S,R,S)-AHPC-PEG3-NH2 (hydrochloride)
HY-103602	MedChemExpress	25mg	EUR 234.00

Thalidomide-O-amido-PEG3-C2-NH2 (TFA)
HY-103611	MedChemExpress	2g	EUR 5675.00

Peg3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4341802	ABM	1.0 ug DNA	EUR 154.00

Peg3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4341803	ABM	1.0 ug DNA	EUR 154.00

Peg3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4341804	ABM	1.0 ug DNA	EUR 154.00

PEG3 sgRNA CRISPR Lentivector (Human) (Target 1)
K1626502	ABM	1.0 ug DNA	EUR 154.00

PEG3 sgRNA CRISPR Lentivector (Human) (Target 2)
K1626503	ABM	1.0 ug DNA	EUR 154.00

PEG3 sgRNA CRISPR Lentivector (Human) (Target 3)
K1626504	ABM	1.0 ug DNA	EUR 154.00

PEG3 Protein Vector (Human) (pPB-C-His)
PV110402	ABM	500 ng	EUR 2280.00

PEG3 Protein Vector (Human) (pPB-N-His)
PV110403	ABM	500 ng	EUR 2280.00

PEG3 Protein Vector (Human) (pPM-C-HA)
PV110404	ABM	500 ng	EUR 2280.00

PEG3 Protein Vector (Human) (pPM-C-His)
PV110405	ABM	500 ng	EUR 2280.00

PEG3 Protein Vector (Mouse) (pPB-C-His)
PV215074	ABM	500 ng	EUR 2646.00

PEG3 Protein Vector (Mouse) (pPB-N-His)
PV215075	ABM	500 ng	EUR 2646.00

PEG3 Protein Vector (Mouse) (pPM-C-HA)
PV215076	ABM	500 ng	EUR 2646.00

PEG3 Protein Vector (Mouse) (pPM-C-His)
PV215077	ABM	500 ng	EUR 2646.00

Peg3 3'UTR Luciferase Stable Cell Line
TU116185	ABM	1.0 ml	Ask for price

Peg3 3'UTR GFP Stable Cell Line
TU166185	ABM	1.0 ml	Ask for price

PEG3 3'UTR GFP Stable Cell Line
TU067722	ABM	1.0 ml	EUR 2333.00

PEG3 3'UTR Luciferase Stable Cell Line
TU017722	ABM	1.0 ml	EUR 2333.00

Anti-ERBB2 (trastuzumab)-Amino-PEG3-Propionyl-MMAE ADC
ADC-W-629	Creative Biolabs	1mg	Ask for price
Description: This ADC product is comprised of an engineerd anti-ERBB2 antibody (trastuzumab with LLQGG tag at Fc) conjugated via a Amino-PEG3-Propionyl linker to MMAE

(S,R,S)-AHPC-C6-PEG3-C4-Cl
HY-103605	MedChemExpress	1g	EUR 3896.00

Mouse Paternally- expressed gene 3 protein, Peg3 ELISA KIT
ELI-20913m	Lifescience Market	96 Tests	EUR 865.00

Human Paternally- expressed gene 3 protein, PEG3 ELISA KIT
ELI-22084h	Lifescience Market	96 Tests	EUR 824.00

Bovine Paternally- expressed gene 3 protein, PEG3 ELISA KIT
ELI-45910b	Lifescience Market	96 Tests	EUR 928.00

PEG3-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV772727	ABM	1.0 ug DNA	Ask for price

PEG3-AS1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV772731	ABM	1.0 ug DNA	Ask for price

PEG3-AS1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV772732	ABM	1.0 ug DNA	Ask for price

Peg3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4341805	ABM	3 x 1.0 ug	EUR 376.00

PEG3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K1626505	ABM	3 x 1.0 ug	EUR 376.00

Peg3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4341808	ABM	1.0 ug DNA	EUR 167.00

Peg3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4341806	ABM	1.0 ug DNA	EUR 167.00

Peg3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4341807	ABM	1.0 ug DNA	EUR 167.00

PEG3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K1626506	ABM	1.0 ug DNA	EUR 167.00

PEG3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K1626507	ABM	1.0 ug DNA	EUR 167.00

PEG3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K1626508	ABM	1.0 ug DNA	EUR 167.00

PEG3-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV772729	ABM	1.0 ug DNA	Ask for price

PEG3-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV772730	ABM	1.0 ug DNA	Ask for price

H2B Antibody Antibody
AF4659	Affbiotech	200ul	EUR 376.00
Description: H2B Antibody Antibody detects endogenous levels of H2B.

CD11b Antibody Antibody
ABD2911	Lifescience Market	100 ug	EUR 438.00

anti- Antibody^Polyclonal antibody control antibody
LSMab09882	Lifescience Market	100 ug	EUR 438.00

Ly1 Antibody Reactive (LYAR) Antibody
20-abx008109	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	0 1 2
Shipped within 5-10 working days.

Anti-Glycolipid Antibody (AGA) Antibody
20-abx004855	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	0 1 2 3
Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody
20-abx123734	Abbexa	EUR 411.00 EUR 592.00	0 1
Shipped within 5-10 working days.

Anti-Glycolipid Antibody (AGA) Antibody
abx036399-100ug	Abbexa	100 ug	EUR 391.00
Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody
20-abx014333	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	0 1 2 3
Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody
abx033330-400ul	Abbexa	400 ul	EUR 523.00
Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody
abx033330-80l	Abbexa	80 µl	EUR 286.00
Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody
20-abx319900	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody
20-abx319901	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody
20-abx319905	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody
20-abx319913	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody
abx234901-100ug	Abbexa	100 ug	EUR 551.00
Shipped within 5-12 working days.

Ly1 Antibody Reactive (LYAR) Antibody
20-abx324434	Abbexa	EUR 314.00 EUR 244.00	0 1
Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody
20-abx311665	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

Anti-Glycolipid Antibody (AGA) Antibody
abx230204-100ug	Abbexa	100 ug	EUR 481.00
Shipped within 5-12 working days.

Anti-Anti-SEPT6 antibody antibody
STJ11100949	St John's Laboratory	100 µl	EUR 277.00
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis. One version of pediatric acute myeloid leukemia is the result of a reciprocal translocation between chromosomes 11 and X, with the breakpoint associated with the genes encoding the mixed-lineage leukemia and septin 2 proteins. This gene encodes four transcript variants encoding three distinct isoforms. An additional transcript variant has been identified, but its biological validity has not been determined.

Anti-Anti-SEPT9 Antibody antibody
STJ111369	St John's Laboratory	100 µl	EUR 277.00
Description: This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described.

Anti-Anti-SEPT11 Antibody antibody
STJ111530	St John's Laboratory	100 µl	EUR 277.00

Anti-Anti-SEPT4 Antibody antibody
STJ112276	St John's Laboratory	100 µl	EUR 277.00
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer.

Anti-Anti-SEPT2 Antibody antibody
STJ25475	St John's Laboratory	100 µl	EUR 277.00

Anti-Anti-SEPT5 Antibody antibody
STJ25477	St John's Laboratory	100 µl	EUR 277.00
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-SEPT8 Antibody antibody
STJ25479	St John's Laboratory	100 µl	EUR 277.00
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT2 Antibody antibody
STJ28365	St John's Laboratory	100 µl	EUR 277.00

Anti-Anti-SEPT7 Antibody antibody
STJ28963	St John's Laboratory	100 µl	EUR 277.00
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-MARCH9 Antibody antibody
STJ112609	St John's Laboratory	100 µl	EUR 277.00

Anti-Anti-SEPT11 Antibody antibody
STJ113941	St John's Laboratory	100 µl	EUR 277.00

Anti-Anti-SEPT11 Antibody antibody
STJ114081	St John's Laboratory	100 µl	EUR 277.00

Anti-Anti-SEPT5 Antibody antibody
STJ114819	St John's Laboratory	100 µl	EUR 277.00
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-MARCH8 Antibody antibody
STJ114828	St John's Laboratory	100 µl	EUR 277.00

Anti-Anti-SEPT7 Antibody antibody
STJ116214	St John's Laboratory	100 µl	EUR 277.00
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-SEPT8 Antibody antibody
STJ117206	St John's Laboratory	100 µl	EUR 277.00
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT12 Antibody antibody
STJ117759	St John's Laboratory	100 µl	EUR 277.00
Description: This gene encodes a guanine-nucleotide binding protein and member of the septin family of cytoskeletal GTPases. Septins play important roles in cytokinesis, exocytosis, embryonic development, and membrane dynamics. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-MARCH6 Antibody antibody
STJ118549	St John's Laboratory	100 µl	EUR 277.00

Anti-Anti-MARCH6 Antibody antibody
STJ118550	St John's Laboratory	100 µl	EUR 277.00

Anti-Anti-MARCH7 Antibody antibody
STJ118752	St John's Laboratory	100 µl	EUR 277.00

Anti-Anti-SEPT3 Antibody antibody
STJ118990	St John's Laboratory	100 µl	EUR 277.00

Anti-Anti-SEPT1 antibody antibody
STJ119580	St John's Laboratory	100 µl	EUR 277.00
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis and the maintenance of cellular morphology. This gene encodes a protein that can form homo- and heterooligomeric filaments, and may contribute to the formation of neurofibrillary tangles in Alzheimer's disease. Alternatively spliced transcript variants have been found but the full-length nature of these variants has not been determined. [provided by RefSeq, Dec 2012]

Cytokeratin 7 antibody-Cytoskeleton Marker Antibody
48169-100ul	SAB	100ul	EUR 333.00

Cytokeratin 7 antibody-Cytoskeleton Marker Antibody
48169-50ul	SAB	50ul	EUR 239.00

Antibody Pair to ApoA-V antibody
10R-1876	Fitzgerald	100 ul	EUR 651.00
Description: Mouse monoclonal Antibody Pair to ApoA-V antibody

Anti CD22 Antibody: CD22 Monoclonal Antibody
065-A-01mg	Virogen	0,1 mg	EUR 267.50
Category: Antibody, Signal Transduction Antibodies, mAb
Description: anti-CD22 monoclonal antibody

Anti CD22 Antibody: CD22 Monoclonal Antibody
065-A-1000ug	Virogen	1000 ug	EUR 1282.50
Category: Antibody, Signal Transduction Antibodies, mAb
Description: anti-CD22 monoclonal antibody

Hepatitis C Virus Antibody (HCV) Antibody
abx023924-1mg	Abbexa	1 mg	EUR 1205.00
Shipped within 5-10 working days.

Ly1 Antibody Reactive Homolog (LYAR) Antibody
20-abx103034	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	0 1 2 3 4
Shipped within 5-7 working days.

Ly1 Antibody Reactive Homolog (LYAR) Antibody
20-abx103035	Abbexa	EUR 467.00 EUR 133.00 EUR 1344.00 EUR 634.00 EUR 342.00	0 1 2 3 4
Shipped within 5-7 working days.

 

 

SUMO4 small interfering RNA attenuates invasion and migration through the JAK2/STAT3 pathway in non-small cell lung most cancers cells

 

• Small ubiquitin-like modifier 4 (SUMO4) is the most recent member of the sumoylation household, which boosts the steadiness of protein, regulates the distribution and localization of the protein, and impacts the transcription exercise of the protein. Nevertheless, the function of SUMO4 in non-small cell lung most cancers (NSCLC) has not but been reported.
• The current research first demonstrated that SUMO4 was upregulated in quite a lot of tissues from sufferers with NSCLC. Immunohistochemistry was carried out to display the expression degree of SUMO4 in lung most cancers tumor tissues. Following the transfection, The EMT standing and signaling pathway activation regulated by SUMO4-siRNA was assessed by western blotting.
• The Transwell and wound therapeutic assays had been carried out to research the regulatory impact of SUMO4-siRNA on cell migration and invasion. Cell Counting Equipment-Eight assay was carried out to research whether or not SUMO4-siRNA affected the chemosensitivity of the NSCLC cells to cisplatin. Statistical evaluation of immunohistochemical outcomes from the tissues confirmed that the overexpression of SUMO4 was considerably related to intercourse, tumor kind, historical past of smoking, T stage and poor prognosis.
• It was additionally recognized that SUMO4 small interfering RNA attenuated invasion and migration in NSCLC cell traces, as effectively chemosensitivity to cisplatin through the inhibition of the JAK2/STAT3 pathway. In conclusion, SUMO4 might play an essential function within the poor prognosis of sufferers with NSCLC. The current research signifies that SUMO4 could also be a possible therapeutic goal for NSCLC.

 

Low-cost RNA extraction technique for extremely scalable transcriptome research

 

RNA extraction has been improved by integration of quite a lot of supplies within the protocol, akin to phenol, guanidine thiocyanate, and silica, in line with the case-specific calls for. Nevertheless, few strategies have been designed for high-throughput RNA preparation for large-scale transcriptome research. On this research, we established a high-throughput guanidinium thiocyanate and isopropyl alcohol based mostly RNA extraction technique (HighGI).

HighGI relies on easy and phenol-free do-it-yourself buffers and the associated fee is considerably decrease than a column-based business package. We demonstrated that the standard and amount of RNA extracted with HighGI had been corresponding to these extracted with a typical phenol/chloroform-based technique and a column-based business package. HighGI retained small RNAs lower than 200 bp, that are misplaced with a business column-based package.

We additionally demonstrated that HighGI is quickly relevant to semi-automated RNA extraction. HighGI permits high-throughput RNA extraction for large-scale RNA preparation with excessive yield and high quality.

Anti-CGA antibody
STJ23110	St John's Laboratory	100 µl	EUR 277.00
Description: The four human glycoprotein hormones chorionic gonadotropin (CG), luteinizing hormone (LH), follicle stimulating hormone (FSH), and thyroid stimulating hormone (TSH) are dimers consisting of alpha and beta subunits that are associated noncovalently. The alpha subunits of these hormones are identical, however, their beta chains are unique and confer biological specificity. The protein encoded by this gene is the alpha subunit and belongs to the glycoprotein hormones alpha chain family. Two transcript variants encoding different isoforms have been found for this gene.

Rabbit Polyclonal antibody Anti-CRBN
Anti-CRBN	ImmunoStep	50 µg	EUR 349.00

Human Chorionic Gonadotropin Alpha Polypeptide (CGa) ELISA Kit
DLR-CGa-Hu-48T	DL Develop	48T	EUR 498.00
Should the Human Chorionic Gonadotropin Alpha Polypeptide (CGa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Chorionic Gonadotropin Alpha Polypeptide (CGa) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Chorionic Gonadotropin Alpha Polypeptide (CGa) ELISA Kit
DLR-CGa-Hu-96T	DL Develop	96T	EUR 647.00
Should the Human Chorionic Gonadotropin Alpha Polypeptide (CGa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Chorionic Gonadotropin Alpha Polypeptide (CGa) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Chorionic Gonadotropin Alpha Polypeptide (CGa) ELISA Kit
RD-CGa-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500.00

Human Chorionic Gonadotropin Alpha Polypeptide (CGa) ELISA Kit
RD-CGa-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692.00

Human Chorionic Gonadotropin Alpha Polypeptide (CGa) ELISA Kit
RDR-CGa-Hu-48Tests	Reddot Biotech	48 Tests	EUR 522.00

Human Chorionic Gonadotropin Alpha Polypeptide (CGa) ELISA Kit
RDR-CGa-Hu-96Tests	Reddot Biotech	96 Tests	EUR 724.00

CGA Antibody
ABD6371	Lifescience Market	100 ug	EUR 438.00

CGA Antibody
32250-100ul	SAB	100ul	EUR 252.00

CgA antibody
10R-2291	Fitzgerald	1 mL	EUR 584.00
Description: Mouse monoclonal CgA antibody

CGA Antibody
DF6371	Affbiotech	200ul	EUR 304.00
Description: CGA Antibody detects endogenous levels of total CGA.

CGA Antibody
CSB-PA005293KA01HU-	Cusabio		EUR 335.00
Form: liquid Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against CGA. Recognizes CGA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

CGA Antibody
CSB-PA005293KA01HU-100ul	Cusabio	100ul	EUR 389.00
Form: liquid Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against CGA. Recognizes CGA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

CGA Antibody
1-CSB-PA292680	Cusabio	EUR 317.00 EUR 244.00	0 1
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CGA. Recognizes CGA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

CGA Antibody
1-CSB-PA131153	Cusabio	EUR 317.00 EUR 244.00	0 1
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CGA. Recognizes CGA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

CGA Conjugated Antibody
C32250	SAB	100ul	EUR 397.00

CgA/ Rat CgA ELISA Kit
ELA-E1212r	Lifescience Market	96 Tests	EUR 886.00

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody
BNC611060-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF660R conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody
BNC611060-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF660R conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody
BNC401060-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF640R conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody
BNC401060-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF640R conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody
BNC431060-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF543 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody
BNC431060-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF543 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody
BNC471060-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF647 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody
BNC471060-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF647 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody
BNC551060-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF555 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody
BNC551060-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF555 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody
BNC051060-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF405M conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody
BNC051060-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF405M conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody
BNC041060-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF405S conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody
BNC041060-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF405S conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody
BNUB1060-100	Biotium	100uL	EUR 209.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), Concentration: 0.2mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody
BNUB1060-500	Biotium	500uL	EUR 458.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), Concentration: 0.2mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody
BNUM1060-50	Biotium	50uL	EUR 395.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), 1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody
BNC681060-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF568 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody
BNC681060-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF568 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody
BNC701060-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF770 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody
BNC701060-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF770 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody
BNC941060-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF594 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody
BNC941060-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF594 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody
BNCH1060-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody
BNCH1060-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody
BNC801060-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF680 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody
BNC801060-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF680 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody
BNCP1060-250	Biotium	250uL	EUR 383.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), PerCP conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody
BNCR1060-250	Biotium	250uL	EUR 383.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), RPE conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody
BNCA1060-250	Biotium	250uL	EUR 383.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), APC conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody
BNCAP1060-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody
BNCAP1060-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody
BNCB1060-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), Biotin conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody
BNCB1060-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), Biotin conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody
BNC881060-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF488A conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody
BNC881060-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF488A conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody
BNC811060-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF680R conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody
BNC811060-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF680R conjugate, Concentration: 0.1mg/mL

Polyclonal Goat anti-GST α-form
GST-ANTI-1	Detroit R&D	50 uL	EUR 280.00

Polyclonal Goat anti-GST μ-form
GST-ANTI-2	Detroit R&D	50 uL	EUR 280.00

Polyclonal Goat anti-GST p-form
GST-ANTI-3	Detroit R&D	50 uL	EUR 280.00

CGA siRNA
20-abx911610	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

CGA siRNA
20-abx911611	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

Polyclonal CGA / hCG Alpha Antibody
APG02559G	Leading Biology	0.1mg	EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human CGA / hCG Alpha . This antibody is tested and proven to work in the following applications:

Monoclonal CGA Antibody, Clone: 2E6B3
APG02561G	Leading Biology	0.1ml	EUR 528.00
Description: A Monoclonal antibody against Human CGA. The antibodies are raised in Mouse and are from clone 2E6B3. This antibody is applicable in WB, E

Monoclonal CGA Antibody, Clone: EP3373
APG02562G	Leading Biology	0.1ml	EUR 528.00
Description: A Monoclonal antibody against Human CGA. The antibodies are raised in Rabbit and are from clone EP3373. This antibody is applicable in WB and IHC

Chromogranin A(CGA/414) Antibody
BNC610414-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against Chromogranin A(CGA/414), CF660R conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody
BNC610414-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against Chromogranin A(CGA/414), CF660R conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody
BNC680414-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against Chromogranin A(CGA/414), CF568 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody
BNC680414-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against Chromogranin A(CGA/414), CF568 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody
BNC400414-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against Chromogranin A(CGA/414), CF640R conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody
BNC400414-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against Chromogranin A(CGA/414), CF640R conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody
BNC430414-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against Chromogranin A(CGA/414), CF543 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody
BNC430414-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against Chromogranin A(CGA/414), CF543 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody
BNC550414-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against Chromogranin A(CGA/414), CF555 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody
BNC550414-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against Chromogranin A(CGA/414), CF555 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody
BNC040414-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against Chromogranin A(CGA/414), CF405S conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody
BNC040414-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against Chromogranin A(CGA/414), CF405S conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody
BNC050414-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against Chromogranin A(CGA/414), CF405M conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody
BNC050414-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against Chromogranin A(CGA/414), CF405M conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody
BNC470414-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against Chromogranin A(CGA/414), CF647 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody
BNC470414-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against Chromogranin A(CGA/414), CF647 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody
BNUM0414-50	Biotium	50uL	EUR 395.00
Description: Primary antibody against Chromogranin A(CGA/414), 1mg/mL

Chromogranin A(CGA/414) Antibody
BNC700414-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against Chromogranin A(CGA/414), CF770 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody
BNC700414-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against Chromogranin A(CGA/414), CF770 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody
BNC940414-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against Chromogranin A(CGA/414), CF594 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody
BNC940414-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against Chromogranin A(CGA/414), CF594 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody
BNCH0414-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against Chromogranin A(CGA/414), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody
BNCH0414-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against Chromogranin A(CGA/414), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody
BNC800414-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against Chromogranin A(CGA/414), CF680 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody
BNC800414-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against Chromogranin A(CGA/414), CF680 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody
BNC810414-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against Chromogranin A(CGA/414), CF680R conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody
BNC810414-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against Chromogranin A(CGA/414), CF680R conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody
BNCP0414-250	Biotium	250uL	EUR 383.00
Description: Primary antibody against Chromogranin A(CGA/414), PerCP conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody
BNCR0414-250	Biotium	250uL	EUR 383.00
Description: Primary antibody against Chromogranin A(CGA/414), RPE conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody
BNCA0414-250	Biotium	250uL	EUR 383.00
Description: Primary antibody against Chromogranin A(CGA/414), APC conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody
BNCAP0414-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against Chromogranin A(CGA/414), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody
BNCAP0414-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against Chromogranin A(CGA/414), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody
BNCB0414-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against Chromogranin A(CGA/414), Biotin conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody
BNCB0414-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against Chromogranin A(CGA/414), Biotin conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody
BNC880414-100	Biotium	100uL	EUR 199.00
Description: Primary antibody against Chromogranin A(CGA/414), CF488A conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody
BNC880414-500	Biotium	500uL	EUR 544.00
Description: Primary antibody against Chromogranin A(CGA/414), CF488A conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody
BNUB0414-100	Biotium	100uL	EUR 209.00
Description: Primary antibody against Chromogranin A(CGA/414), Concentration: 0.2mg/mL

Chromogranin A(CGA/414) Antibody
BNUB0414-500	Biotium	500uL	EUR 458.00
Description: Primary antibody against Chromogranin A(CGA/414), Concentration: 0.2mg/mL

CGA cloning plasmid
CSB-CL005293HU1-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 351 Sequence: atggattactacagaaaatatgcagctatctttctggtcacattgtcggtgtttctgcatgttctccattccgctcctgatgtgcaggattgcccagaatgcacgctacaggaaaacccactcttctcccagccgggtgccccaatacttcagtgcatgggctgctgcttctctag Show more
Description: A cloning plasmid for the CGA gene.

CGA cloning plasmid
CSB-CL005293HU2-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 351 Sequence: atggattactacagaaaatatgcagctatctttctggtcacattgtcggtgtttctgcatgttctccattccgctcctgatgtgcaggattgcccagaatgcacgctacaggaaaacccattcttctcccagccgggtgccccaatacttcagtgcatgggctgctgcttctctag Show more
Description: A cloning plasmid for the CGA gene.

CGA Rabbit pAb
A1239-100ul	Abclonal	100 ul	EUR 308.00

CGA Rabbit pAb
A1239-200ul	Abclonal	200 ul	EUR 459.00

CGA Rabbit pAb
A1239-20ul	Abclonal	20 ul	EUR 183.00

CGA Rabbit pAb
A1239-50ul	Abclonal	50 ul	EUR 223.00

CGA Blocking Peptide
DF6371-BP	Affbiotech	1mg	EUR 195.00

Anti-Chromogranin A/ CHGA Antibody Clone CGA/414, Unconjugated-100ug
1113-MSM1-P1	EnQuireBio	100ug	EUR 428.00

Anti-Chromogranin A/ CHGA Antibody Clone CGA/413, Unconjugated-100ug
1113-MSM9-P1	EnQuireBio	100ug	EUR 428.00

Glycoprotein Hormones Alpha Chain (CGA) Antibody
abx117075-100ug	Abbexa	100 ug	EUR 467.00
Shipped within 5-10 working days.

Glycoprotein Hormones Alpha Chain (CGA) Antibody
20-abx001151	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	0 1 2 3
Shipped within 5-10 working days.

Chorionic Gonadotropin Alpha Polypeptide (CGa) Antibody
20-abx104052	Abbexa	EUR 411.00 EUR 133.00 EUR 1149.00 EUR 565.00 EUR 314.00	0 1 2 3 4
Shipped within 5-7 working days.

Chorionic Gonadotropin Alpha Polypeptide (CGa) Antibody
20-abx104053	Abbexa	EUR 300.00 EUR 133.00 EUR 801.00 EUR 425.00 EUR 258.00	0 1 2 3 4
Shipped within 5-12 working days.

Glycoprotein Hormones Alpha Chain (CGA) Antibody
abx215829-100ug	Abbexa	100 ug	EUR 439.00
Shipped within 5-10 working days.

Glycoprotein Hormones Alpha Chain (CGA) Antibody
abx224103-100ug	Abbexa	100 ug	EUR 411.00
Shipped within 5-10 working days.

Glycoprotein Hormones Alpha Chain (CGA) Antibody
20-abx210782	Abbexa	EUR 411.00 EUR 300.00	0 1
Shipped within 5-10 working days.

Glycoprotein Hormones Alpha Chain (CGA) Antibody
20-abx210783	Abbexa	EUR 411.00 EUR 300.00	0 1
Shipped within 5-10 working days.

Glycoprotein Hormones Alpha Chain (CGA) Antibody
20-abx225107	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	0 1 2
Shipped within 5-10 working days.

Chorionic Gonadotropin Alpha Polypeptide (CGa) Antibody
20-abx171737	Abbexa	EUR 328.00 EUR 815.00 EUR 425.00 EUR 154.00 EUR 258.00	0 1 2 3 4
Shipped within 5-12 working days.

Human CGA ELISA Kit
ELA-E0441h	Lifescience Market	96 Tests	EUR 824.00

CGA ELISA KIT|Human
EF004143	Lifescience Market	96 Tests	EUR 689.00

Human CGA shRNA Plasmid
20-abx950777	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Mouse CGA shRNA Plasmid
20-abx969656	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

CGA Recombinant Protein (Human)
RP006901	ABM	100 ug	Ask for price

CGA Recombinant Protein (Human)
RP006904	ABM	100 ug	Ask for price

CGA Recombinant Protein (Rat)
RP194735	ABM	100 ug	Ask for price

CGA Recombinant Protein (Mouse)
RP123761	ABM	100 ug	Ask for price

Human CGA ELISA Kit
STJ150209	St John's Laboratory	1 kit	EUR 412.00
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of HCG in human serum, plasma and other biological fluids

Anti-Chromogranin A / CHGA Antibody (CGA/413 + CHGA/777 + CHGA/798)
A1576-100	Biovision		EUR 479.00

Chorionic Gonadotropin Alpha Polypeptide (CGa) Antibody (FITC)
20-abx273928	Abbexa	EUR 495.00 EUR 258.00 EUR 1455.00 EUR 676.00 EUR 398.00	0 1 2 3 4
Shipped within 5-15 working days.

Chorionic Gonadotropin Alpha Polypeptide (CGa) Antibody (Biotin)
20-abx272165	Abbexa	EUR 439.00 EUR 244.00 EUR 1261.00 EUR 606.00 EUR 328.00	0 1 2 3 4
Shipped within 5-7 working days.

Chorionic Gonadotropin Alpha Polypeptide (CGa) Antibody (Biotin)
20-abx272885	Abbexa	EUR 467.00 EUR 244.00 EUR 1344.00 EUR 634.00 EUR 342.00	0 1 2 3 4
Shipped within 5-15 working days.

Anti-Chromogranin A/ CHGA Antibody Clone LK2H10 + PHE5 + CGA/414, Unconjugated-100ug
1113-MSM5-P1	EnQuireBio	100ug	EUR 428.00

Rat Chromogranin(CgA)ELISA Kit
GA-E0565RT-48T	GenAsia Biotech	48T	EUR 317.00

Rat Chromogranin(CgA)ELISA Kit
GA-E0565RT-96T	GenAsia Biotech	96T	EUR 496.00

Human Chromogranin,CgA ELISA Kit
201-12-1731	SunredBio	96 tests	EUR 440.00
This Chromogranin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Chromogranin A (CgA) ELISA Kit
K4241-100	Biovision		EUR 914.00

Human Chromogranin,CgA ELISA Kit
CN-04332H1	ChemNorm	96T	EUR 486.00

Human Chromogranin,CgA ELISA Kit
CN-04332H2	ChemNorm	48T	EUR 336.00

Human Chromogranin, CgA ELISA Kit
CSB-E09153h-24T	Cusabio	1 plate of 24 wells	EUR 165.00
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Chromogranin, CgA in samples from serum, plasma, cell culture supernates, urine, cerebrospinalfluid (CSF). A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Chromogranin, CgA ELISA Kit
1-CSB-E09153h	Cusabio	EUR 900.00 EUR 5476.00 EUR 2900.00	0 1 2
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Chromogranin, CgA in samples from serum, plasma, cell culture supernates, urine, cerebrospinalfluid(CSF). Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

CGA ORF Vector (Human) (pORF)
ORF002301	ABM	1.0 ug DNA	EUR 95.00

CGA ORF Vector (Human) (pORF)
ORF002302	ABM	1.0 ug DNA	EUR 95.00

Cga ORF Vector (Mouse) (pORF)
ORF041255	ABM	1.0 ug DNA	EUR 506.00

Cga ORF Vector (Rat) (pORF)
ORF064913	ABM	1.0 ug DNA	EUR 506.00

pGL3-Basic-CGA promoter Plasmid
PVTB80059-2a	Lifescience Market	2 ug	EUR 356.00

Rat Chromogranin(CgA)ELISA Kit
QY-E11087	Qayee Biotechnology	96T	EUR 361.00

Mouse Chromogranin(CgA)ELISA Kit
QY-E20322	Qayee Biotechnology	96T	EUR 361.00

Chorionic Gonadotropin Alpha Polypeptide (CGa) Polyclonal Antibody (Human)
4-PAB612Hu01	Cloud-Clone	EUR 239.00 EUR 2391.00 EUR 598.00 EUR 299.00 EUR 211.00	0 1 2 3 4
Sequence of the immunogen: Leu25~Ser120 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chorionic Gonadotropin Alpha Polypeptide (CGa)

Chorionic Gonadotropin Alpha Polypeptide (CGa) Polyclonal Antibody (Mouse)
4-PAB612Mu01	Cloud-Clone	EUR 243.00 EUR 2457.00 EUR 613.00 EUR 305.00 EUR 212.00	0 1 2 3 4
Sequence of the immunogen: CGa (Leu25~Ser120) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Chorionic Gonadotropin Alpha Polypeptide (CGa)

Chorionic Gonadotropin Alpha Polypeptide (CGa) Monoclonal Antibody (Human)
4-MAB612Hu22	Cloud-Clone	EUR 247.00 EUR 2516.00 EUR 626.00 EUR 310.00 EUR 214.00	0 1 2 3 4
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Mouse monoclonal antibody against Human Chorionic Gonadotropin Alpha Polypeptide (CGa)

Human CGA(Chromogranin A) ELISA Kit
EH0486	FN Test	96T	EUR 524.10
Detection range: 0.781-50 ng/ml Uniprot ID: P10645 Alias: CGA(Chromogranin A)
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469 ng/ml

Human Chromogranin A(CgA)ELISA Kit
GA-E1747HM-48T	GenAsia Biotech	48T	EUR 289.00

Human Chromogranin A(CgA)ELISA Kit
GA-E1747HM-96T	GenAsia Biotech	96T	EUR 466.00

CGA sgRNA CRISPR Lentivector set (Human)
K0439501	ABM	3 x 1.0 ug	EUR 339.00

Cga sgRNA CRISPR Lentivector set (Mouse)
K4766201	ABM	3 x 1.0 ug	EUR 339.00

Cga sgRNA CRISPR Lentivector set (Rat)
K7098601	ABM	3 x 1.0 ug	EUR 339.00

Recombinant Chorionic Gonadotropin Alpha Polypeptide (CGa)
4-RPB612Hu01	Cloud-Clone	EUR 458.40 EUR 226.00 EUR 1444.00 EUR 548.00 EUR 996.00 EUR 370.00 EUR 3460.00	0 1 2 3 4 5 6
Uniprot ID: Inquire Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 11.7kDa Isoelectric Point: Inquire
Description: Recombinant Human Chorionic Gonadotropin Alpha Polypeptide expressed in: E.coli

Recombinant Chorionic Gonadotropin Alpha Polypeptide (CGa)
4-RPB612Mu01	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	0 1 2 3 4 5 6
Uniprot ID: P01216 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 11.9kDa Isoelectric Point: 8.7
Description: Recombinant Mouse Chorionic Gonadotropin Alpha Polypeptide expressed in: E.coli

Human Chromogranin A(CgA)ELISA Kit
QY-E01515	Qayee Biotechnology	96T	EUR 361.00

Anti-Chromogranin A/ CHGA Antibody Clone CGA/413 + CHGA/777 + CHGA/798, Unconjugated-100ug
1113-MSM10-P1	EnQuireBio	100ug	EUR 428.00

Chorionic Gonadotropin Alpha Polypeptide (CGa) Polyclonal Antibody (Human), APC
4-PAB612Hu01-APC	Cloud-Clone	EUR 333.00 EUR 3113.00 EUR 872.00 EUR 423.00 EUR 215.00	0 1 2 3 4
Sequence of the immunogen: Leu25~Ser120 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chorionic Gonadotropin Alpha Polypeptide (CGa). This antibody is labeled with APC.

Chorionic Gonadotropin Alpha Polypeptide (CGa) Polyclonal Antibody (Human), Biotinylated
4-PAB612Hu01-Biotin	Cloud-Clone	EUR 303.00 EUR 2341.00 EUR 697.00 EUR 369.00 EUR 216.00	0 1 2 3 4
Sequence of the immunogen: Leu25~Ser120 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chorionic Gonadotropin Alpha Polypeptide (CGa). This antibody is labeled with Biotin.